Can anyone work on this?

BE4910: Industrial Molecular Biotechnology, Spring 2020

Lab Report

Name:

Overall experiment description

• Cloning sfGFP gene into the pET-21a(+) vector for the overexpression of sfGFP in E. coli strain BL21(DE3).

• We will induce the cell by IPTG to regulate transcription and translation.

• Expressed sfGFP will be purified by using HisTag affinity chromatography.

• Gene of Interest: Super Folder Green Fluorescence Protein (sfGFP)

• Vector: pET-21a(+)

Tasks

1. Identify names of promoter and terminator in the given vector sequence.

2. Identify nucleotide sequence of the ribosome binding site and HisTag.

3. Select two restriction endonucleases and put the names and sequences.

4. Design your forward and reverse primers for sfGFP gene amplification and i) show your primer sequences, ii) length (# of nucleotide), iii) GC%, iv) Tm.

- Primers must include your restriction endonucleases.

• Primer calculators:

http://www.oligoevaluator.com/LoginServlet

https://www.thermofisher.com/us/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/multiple-primer-analyzer.html

5. Discuss your PCR strategy. i) Temperature and reaction time at each step and give reasons why you select that condition, ii) number of cycles, iii) how many copies will you expect based on your PCR condition.

6. What are you going to do next to achieve the experiment goal? List the names of experiments with a short description.

• Nucleotide sequence of sfGFP:

ATGAGCAAAGGTGAAGAACTGTTTACCGGCGTTGTGCCGATTCTGGTGGAACTGGATGGCGATGTGAACGGTCACAAATTCAGCGTGCGTGGTGAAGGTGAAGGCGATGCCACGATTGGCAAACTGACGCTGAAATTTATCTGCACCACCGGCAAACTGCCGGTGCCGTGGCCGACGCTGGTGACCACCCTGACCTATGGCGTTCAGTGTTTTAGTCGCTATCCGGATCACATGAAACGTCACGATTTCTTTAAATCTGCAATGCCGGAAGGCTATGTGCAGGAACGTACGATTAGCTTTAAAGATGATGGCAAATATAAAACGCGCGCCGTTGTGAAATTTGAAGGCGATACCCTGGTGAACCGCATTGAACTGAAAGGCACGGATTTTAAAGAAGATGGCAATATCCTGGGCCATAAACTGGAATACAACTTTAATAGCCATAATGTTTATATTACGGCGGATAAACAGAAAAATGGCATCAAAGCGAATTTTACCGTTCGCCATAACGTTGAAGATGGCAGTGTGCAGCTGGCAGATCATTATCAGCAGAATACCCCGATTGGTGATGGTCCGGTGCTGCTGCCGGATAATCATTATCTGAGCACGCAGACCGTTCTGTCTAAAGATCCGAACGAAAAACGGGACCACATGGTTCTGCACGAATATGTGAATGCGGCAGGTATTACGTAG

• Nucleotide sequence of pET-21a

• Map of pET-21a