DescribetherolesofCRISPR/Cas9andsgRNAinthenucleasesystem.

9 November 20 20 9am - : 10 November 2020 9am ASSESSOR(S) :

DR MH Serepa - Dlamini MODERATOR : Dr A M Abrahams DURATION : 24 Hours MARKS : 10 0 NUMBER OF PAGES: 5 PAGES INSTRUCTIONS: 1. Number your answers clearly. 2. Please submit a typed exam. 3. You have 24 hours to write this exam. 4. Submit on 10 November 2020 9am through email to Dr MH Serepa -Dlamini and post a copy of your submission on Turn it in earlier or 30 minutes before due time. 5. All the Best. Page | 2 BTN1GB1 SECTION A Question 1 a. Describe the role s of CRISPR/Cas9 and sgRNA in the nuclease system . [10] Page | 3 SECTION B Question 1 1) Define the following terms as they are used in molecular biology. i) Genomics ii) Proteomics iii) Structural genomics iv) Functional genomics v) Deoxyr ibonucleic acid. (2 Marks each) 2) The sequences of promoters tend to be rich in A and T residues. Explain why this is so. (2 Marks) 3) The sequence of a con sensus -10 region is TATAAT. If two genes, tesA and tesB have identical promoter sequences except in the -10 region, where the tesA sequence is TATAAT and the tesB sequence is TGTCGA, which gene do you expect to be more efficiently transcribed, and why? (5 Marks) 4) The gene encoding the E. coli enzyme β -galactosidase begins with the sequence 5’ ATGACCATGATTACG 3’. What is the sequence of the mRNA transcript and amino acid names specified by this part of the gene? (8 Marks) [25] Question 2 1) The drawing below represents a simultaneous transcription in bacteria. Answer the questions that follow, the direction of RNA pol is given by the arrow. I II III C Page | 4 a) The letter B is nearest to which end of which molecule? (2) b) Which end of the polypeptide chain is near to the letter E? (1) c) Which ribosome began translation first? (1) d) What type of RNA is within the large ribosomal subunit ? (1) e) What is the size of the large ribosomal subunit ? (1) f) Which subunit of the ribosome initiates translation? (1) g) The letter A is next to which end of which molecule? (2) h) What does the letter C represent? (1) [10] Question 3 1) Translate the following mRNA into protein, starting from the first initiation codon. 5′CCGAUGGCCAUGGCAGCUCGGUGUUACAAGGCUUGCAUCAGUACCAGUUU GAAUCC -3′ (10 Marks ) 2) Name and discuss the three steps involved in translation in both prokaryotes and eukaryote (15 Marks) [25] Question 4 1) During mismatch repair, why is it necessary to distinguish between the template strand and the newly made daughter strand? How is this accomplished? (10 marks) 2) A double stranded DNA contains 10% guanine, what is the percentage of adenine. Show all your calculations (4 marks) 3) A tRNA has the anticodon sequence 3ʹ –CAG –5ʹ. What amino acid does it carry? (3 Marks) 4) The gene sequence below runs in the 5’ -3’ direction and codes for the bacterial ATP synthase subunit beta AtpD protein. 1 atggcaactg gaaagattgt ccagattatc ggcgccgttg ttgacgtcga attccctcag 61 gacgcggtac cgcaagtgta cagcgccctc gaggttatga atggtgatgc gcgtctggtg 121 ctggaagttc agcagcagct cggcggcggc gta gtacgta ccatcgcaat gggtacgtct 181 gacggcctga agcgtggtct gagcgtcaac gacctgcaga aaccgattca ggtacccgtc 241 ggtaaagcga ccctgggccg tatcatgaac gttctcggcg agccaatcga tatgaaaggc 301 gagctgaaag aagaagatgg cagcgcagta gagatcgcct ctattcaccg cgcagcccct 361 tcttatgaag atcagtctaa ctcgcaggaa ctgctggaaa ccggcatcaa ggttatcgac 421 ctgatgtgtc cgtttgctaa aggcggtaaa gtcggtctgt tcggtggtgc gggtgtaggt 481 aaaaccgtca acatgatgga actgatccgt aacatcgcgg ctgaacactc aggttactca 541 gtgtttgccg gtgtgggtga gcgtactcgt gagggtaacg acttctacca cgaaatgact 601 gactctaacg ttatcgataa agttgcactg gtctatggcc agatgaacga gccgccgggt 661 aaccgtctgc gcgtagcact gaccggtctg accatggcgg aaaaattccg tgatgaaggc Page | 5 721 cgcgacgttc tgctgttcat cgataa catc taccgttata ccctggccgg tacagaagtt 781 tctgcactgc tgggtcgtat gccatctgcg gtaggttacc agccaacgct ggcagaagag 841 atgggtgtgt tgcaggagcg tattacctcc accaagaccg gttcaatcac ctccgtacag 901 gccgtttacg tccctgcgga tgacctgact gacccatcac cagcaactac c tttgcgcac 961 ttagactcaa cggtaacgct gagccgtcag atcgcctctc tgggtatcta cccggccgtt 1021 gacccgctgg actctaccag ccgtcagctg gatccgctgg ttgtcggtca ggagcactat 1081 gatgttgcac gtggcgttca gtcactgctg cagcgttatc aggaactgaa agacatcatc 1141 gccatcct cg gtatggatga gctgtctgaa gaagacaaac tgctggtggc acgtgcgcgt 1201 aagattcagc gcttcctgtc tcagccgttc ttcgttgcag aagtattcac cggttcaccg 1261 ggcaaatacg tgacgctgaa agacactatc cgtggcttta aaggcatcat ggaaggtgag 1321 tttgaccacc tgccagagca ggccttctac atg gttggcg ccatcgaaga agccgtggaa 1381 aaagcgaaga aactgtaa 1. Design primers to amplify the gene. (6) 2. Calculate the Tm for each primer. (3) 3. Determine the suitable annealing temperature. (2) 4. What is the expected PCR product length in bp? (2) [30]