Need help with a small lab report on Genetics. The report guidelines, the notes powerpoint and results to analyze are attached. please ask if there are any questions about this report

Because of this high toxicity level , a number of ot her DNA stains have been developed that may be employed. Each has its own advantages a nd disadvantages (sensitivity, toxicity, light sensitivity, migration properties , ease of addition to gel , othe r staining issues) that must be evaluated when decisions a re bein g made about the most suitable st aining system to use. After staining with EtBr (or another DNA binding stain) the gel is exposed to ultraviolet light which leads to visible light fluorescence by the DNA bound stain molecules. The fluorescence is photogr aphed (using a colored filter in order to produce a high quality black & white i mage) to produce a permanent record of the electrophoresis. Different stains produce different colors of fluorescence which affects the color of the filter used. In or der to photograph the gel it is viewed on an ultraviolet light transilluminator . Speci fically, in our lab the Gel -Doc system is used that allows simultaneous viewing, photography and computer image storage. The pattern of fragments produced by digesting a specif ic DNA sequence with a particular restriction endonuclease can be considered ana logous to a fingerprint. NOTE: Gels conatining EtBr should be handled only with gloved hands and in general the Instructor will be responsible for all procedures invol ving Et Br. 23 A B C D E F A B C D E F a) Mould, comb and gel b) Comb removed, leaving wells empty c) Surface view of gel an d wells d) Gel containing EtBr visualized using a UV transilluminator showing orange light fluorescence Figure 4 – Agarose ge ls and electrophoresis. a) and b) side view of gel and plexiglass tray, with and with ou t the comb in place. c) S urface vi ew of gel containing ethidiu m bromide after electrophoresis under visible light conditions and d) under UV illumination showing the res ulting orange fluorescence. Lane A – MW markers; Lane B – Ycplac33 plasmid digested w ith Hin dIII restriction enzyme; Lane s C – F – recombinant YCplac33 plasmids digested with Hin dIII restriction enzyme. 24 Lab 3 Module - D(iii) Performing the Electrophoresis: Wa tch the 2 supplemental lab videos on running the electrophoresis gel and use of the GelDoc. The ge l, prepared at an earlier date , has been returned to the tray to support it during elec trophor esis and the running buffer, 1X TAE has been added to the reservoirs and to a depth of 2 -3 mm over the gel. You are ready to load your restriction enzyme digests into the wells of the gel. 1. A standard kilobase ladder has been prepared for you. The I nstruct or will load 20 µl of the 1.0 Kilobase Ladder into the wells of an agarose gel. The la dder contains fragments of 9000, 8000, 7000, 6000, 5000 , 4000, 3000, 2000, 1650, 1000, 850, 650 , 500, 400 , 300, 200, and 100 bp. The 1650 band shows up as the brig htest after staining with ethidium bromide . This band is located and used to identify the rest of the markers by tracking up and down from this pos ition. 2. The restriction enzyme digests are denser than the buffer because of the glycerol pres ent in the Tra cking d ye mix that was added to terminate the reactions. The samples can be very gently loaded into the wells using the micropipettes and the heavy sample will displace the buffer from the well. Samples must be loaded slowly and gently to ens ure that they remain in the well. The micropipette tip needs to be close to the bottom of the well but caution is required not to puncture a hole in the bottom of the well. In this case the entire sample will leak out of the gel and migrate in the electrop horetic field underne ath the gel. Unlike usual pipetting technique, when adding the samples to the wells, the micropipette tip must be removed from the well befor e the plunger is released so that the sample is not disturbed in the well. The Instructor wil l demonstrate the tec hnique used to load your samples onto the gel (shown in supplemental lab video) . 3. Vortex (5 sec) and centrifuge (30 sec) all digest samples before loading the samples into the gel. Load 20 µl samples from the Hin dIII digests into 5 wells as instruct ed. Similarly, load 20 µl samples from th e Eco RI digests into 5 wells. Use a fresh pipette tip for each sample. Make sure to record the position of your samples on the gel sign up s heet. 4. Electrophorese the samples at 100 volts until the bromophenol blue b and is about 1.0 cm from the end of the g el. This will take 60 to 75 minutes. 5. You r Instructor will v iew the gel under UV exposure and p hotograph the resulting fluoresce nce . The gel photo will be posted on Nexus under the Lab 3 Module for analysis . The La b 3 Exercise D Assign ment found unde r the Lab 3 Module is due by 11:59 PM on Wed, Feb. 1 7th ** NOTE : this is du ring th e Winter Te rm Reading Week ** 25 Lab 4 Module - Exercise E: Preparation of Competent E. coli DH5 α If log phase cells of E. coli are treated with polyethylene glycol (PEG) and dimethyl sulphoxide (DM SO) they become competent ( are capable of taking up DNA fro m the extracellular medium and expressing the DNA genetically) and can be transformed by plasm id DNA. The plasmid molecules are taken up, replicate, and express the genes for antibiotic resistance; this allows the selection of transformed cells on appropri ate media and subsequently allows for the full characterization of the plasmid molecules. Mat erials: 10 ml culture of DH5 α TSS (LB broth + 10% PEG, 5% DMSO, 20 mM MgCl 2, pH 8.0) on ice. Procedure: Note – you are not per forming the actual procedures during the Winter 2021 term 1. Label 6 microfuge tubes with your initials and place them on ice so that they may be cold for step 4 of this procedure. 2. TIMING IS CRITICAL FOR THIS PROCEDURE!! As SOON as you are provided with a 15 ml culture tube that has been centrifuged to pellet the log phase cells of E. coli you must IMMEDIATELY pour off the supernatant from the DH5 α and add 1000 µl of ic e-cold TSS to the pellet. 3. Resuspend the cells by vortexing and then plac e the tube in ice/water for 15 minutes. 4. After the 15 minutes the cells are VERY fragile. Gently swirl the tube to produce a homogenous suspension. NO vortexing!! Pipette 100 µl of cell suspension into each of the six cold microfuge tubes that you labeled i n step 1. 5. Leave your 6 microfuge tubes on ice. They will be collected and frozen at -70 ◦C until needed. Lab 4 Module - Exercise F Transformation of DH5 α with plasmid DNA In this exercise the competent DH5  cells prepared will be transformed using your plasmid preparations from Exercise B. Cell density of the transformed cell suspension can be determined by plating some of the transformation sample on non -selective medium . This will allow transformation efficiencies for the different plasmid preparations to be calculated. Materials: Plasmid DNA preparations from Strains 1 to 5 & the c lass pre paration from Strain 6; microfuge tubes of competent DH5 α cells prepared earlier; a tube of sterile LB broth + 20 mM glucose; plates of LB and LB + amp ; sterile blue spreaders. Procedure: Note – you are not per forming the actual procedures during the Winter 2021 term 1. Allow the six tubes of frozen competent DH5 α cells to thaw in ice/water . Label the se competent cell tubes 1 -6. 2. Each competent DH5 α cell tube needs to have 200 ng of the appropriate plasmid DNA added to it. Refer to your table on page 1 4 where you determined (according to your NanoDrop results) how many microliters you would need to add of each of th e 6 strains in order to add 200 ng of plasmid DNA to the competent cells. 3. Vortex your plasmid DNA preparations. Pipette the calculated volume (µl) of each plasmid DNA preparation into the appropriately labeled competent cell tube. For example, if you calc ulated that 6.2 µl of Strain 1 would contain 200 ng of plasmid DNA, then you pipette 6.2 µl from your Strain 1 plasmid isolation tube into competent cell tube #1. If you calculated that 7.4 µl of Strain 2 would contain 200 ng of plasmid DNA, then you pipe tte 7.4 µl from your Strain 2 plasmid isolation tube into competent cell tube #2 etc. Use a different pipette tip for each tube 26 and suck the suspension up and down several times to insure complete mixing of the plasmid and the cells. 4. Mix the contents of th e each tube by tapping gently with a finger. DO NOT vortex. 5. Keep the tubes on ice for 40 minutes. 6. Add 900 µl of LB broth + 20 mM glucose to each microfuge tube and mix gently by sucking the suspension up and down as well as tapping the tube with a finger . 7. Pipette the suspensions into 15 ml tubes and incubate at 37 ◦C with shaking at 200 rpm for 60 minutes. 8. Label 6 LB + Amp plates with the plasmid types used. 9. After the 60 minute incubation, swirl each tube b efore you pipette 100 µl of each suspension onto the appropriately labeled LB + Amp plate . Spread the suspensions over the ag ar surface with a sterile spreader. 10. The plates will be incubated at 37 ◦C for 24 hours . Pictures of the plates wi ll be post ed on Ne xus under the Lab 4 Module . 11. To determine the transformation efficiency the total number of cells available to be transformed must be determined. All 6 sa mples should be analyzed individually using the following procedure, but in order to simplify the proce ss, the cell density fo r sample 6 alone will be determined. Since all tubes of competent cells originated from the same stoc k preparation this is accurate enough for our purposes. 12. The cell density of the culture used to prepare your competent cells was qui te high so dilutions are required to determine the cell density. Prepare dilution tubes by labeling 3 microfuge tubes 10 -2, 10 -4 and 10 -5. Pipette 1.0 ml of the LB broth + 20 mM glucose into the first 2 microfuge tubes and pipette 900 µl of the same into the third microfuge tub e. 13. Add 10 µl of strain 6 cells to the 10 -2 microfuge tube. Gently mix and then transfer 10 µl from this tube into the 10 -4 microfuge tube and mix. Finally transfer 100 µl from the 10 -4 microfuge tube in the 10 -5 microfuge tube and mi x. 14. Spread 100 µl sample s of the 10 -5 dilution onto 2 plates of LB agar and incubate at 37 ◦C for 24 -36 hours. Pictures of these plates will be posted on Nexus under the Lab 4 Module and will be used to determine the original cell density of the competent ce ll culture . The Lab 4 Assign ment found unde r the Lab 4 Module is due by 11:59 PM on Wed, Feb. 24 th. 27 Lab 5 Module – PCR Investigation of a VNTR Polymorphism at the D1S80 Locus on Human Chromosome 1 Variable number tandem repeats (VNTRs) were first characterized by restriction enzyme digest ion and Southern Blottin g. Amplification of the repeated sequences by PCR has subsequently proved to be more sensitive and specific and is now the method of choice. In this exercise we shall investigate a VNTR known as D1S80 or pMCT118 located on human chr omosome 1 at bands 1p36/ 35. This VNTR has been extensively used in population studies and in forensics. It is based on a core repeat of 16 bp. The ‘basic’ allele is comprised of 18 repeats of the core sequence assoc iated with 85 bp of unique sequence DNA. The VNTR is detected by PCR with two specific primers, one of 28 bp and the other 29 bp. PCR amplification of the base allele results in a 430 bp product; additional alleles show increments of 16 bp up to 750 bp. At least 28 different alleles and over 50 d ifferent genotypes have been identified. We shall use DNA obtained from the class by buccal scraping s. Cells from the inside of the cheek are scraped off and then digested at 75 °C in 0.2 M NaOH. The NaOH is neutral ized and the reaction terminated with Tri s-HCl, pH 7.5. The VNTR is then amplified by PCR using the following primers: D1S80 PCR1.1 (forward) 5’ GAAACTGGCCTCCAAACACTGCCCGCCG 3’ D1S80 PCR1.2 (reverse) 5’ GTCTTGTTGGAGATGCACGTGCCCCTTGC 3’ The samples are am plified using PCR and then analyzed by ag arose gel electrophoresi s and staining with ethidium bromide. Ther e are 3 steps to this procedure: Note – you are not per forming the actual procedures during the Winter 2021 term Step 1. DNA Sample preparation Ma terials: Sterile, plastic drinking straws with a diagonal cut; 1 .5 ml microfuge tubes; 0.2 M NaOH; 100 mM Tris -HCl (pH 7.5). 1. Use the diagonal ly c ut end of the straw to scrape the inside portion of your cheek several times to remove some of the epithelial cells from the mucosal lining. You MUST put enough pressure int o scraping the inside of your check so you can actually FEEL it. 2. Place the str aw, cut end down, inside a 1.5 ml microfuge tube. Use scissors to cut off the extra straw length. 3. Pipette 25 µl o f 0.2 M NaOH in and around the tip of the straw in the microfuge tube. Note: put your micropipette tip to the bottom of the microfuge tube so t hat you may use the NaOH to wash the cells off of the straw tip. 4. Wrap the lid of the microfuge tube securely with Parafilm TM before p lac ing the tube in a 75 °C degree water bath for ten minutes. Watch your time as you must not exceed ten minutes!! 5. Remove the tube from the water bath and add 90 µl of 100 mM Tris in and around the tip of the straw in the microfuge tub e. Note: put your micropipette tip to the bottom of the microfuge tube so that you may use the 100 mM Tris to wash the cells off of the straw t ip. Intentionally catch the top of the straw in the microfuge tube lid when you close the microfuge tube, so the straw will not fall to the bottom of the tube during the spin in step 6. 28 6. Microcentrifuge the tube at top speed for 15 seconds. 7. Carefully r emove the straw and store tube on ice until ready to use in Ste p 2 below . Step 2. PCR amplification of DNA samples M ateri als: 200 µl PCR tubes, PCR Mixes, DNA samples, PCR machine progr ammed for 35 cycles: using the following cycle characteristics - denat uration at 96 C for 60 seconds, annealing at 60 C for 80 seconds, primer extension at 72 C for 60 seconds. 1. In order to h ave a polymerase chain reaction occur your reaction tube must con tain: DNA template, all 4 nucleotides (triphosphates), the rmostabl e DNA polymerase enzyme (usually Taq), appropriate buffer (usually containing MgCl 2) forward and reverse primer oligonuc leoti des in a typical volume of 50 l. For an individual PCR reaction tubes the volumes of many of these additions is extremely small an d consequently bulk mixes in some form are normally prepared. Bulk mixes labeled A and B have been prepared for you. NOTE: BULK MIXES A & B MUST BE ON ICE AT ALL TIMES AND NEVER ALLOWED T O DROP IN TEMPERATURE!! 2. Each of your PCR tubes will be pr epared t o contain: 15 µl Mix A 25 µl Mix B 10 µl DNA sample (individually prepared earlier in Step 1) The contents of Mix A an d B are: Mix A (15 µl) Mix B (25 µl) 1 µl Nucleotide Mix ( 10mM of each of dATP, dGTP, dTTP, dCTP) 5 µl 10X Taq Buffer (10 0 mM Tri s/HCl, 500 mM KCl) 1 µl D1S80 primer 1(25 µM) 1 µl Taq Enzyme 1 µl D1S80 primer 2 (25 µM) 3 µl MgCl 2 (25 mM) 12 µl steril e water 16 µl sterile water 3. VORTEX Mix A, Mix B and your DNA sam ple before use. Pipette 15 µl of Mix A and 25 µl of Mix B into a fresh PCR tube . Then a dd 10 µl of your DNA sample (prepared in Step 1) to this PCR tube. Flick the PCR tube a few times to mix the se THREE ingredients . 4. Centrifuge at top speed for 2 se conds. To centrifuge the PCR tubes, because they are only 200 µl in size, the PCR tubes are placed inside 1.5 ml tubes (lids removed) that act as sleeves in the microfuge. 5. Place the PCR tube int o the ice chest next to the PCR machine. 6. Once all of the sampl es are in the ice chest , the Instructor will load the PCR tubes in to the heating/cooling block of the PCR machine. The Instructor will record the location of your tube , since the labels on t he tubes are often easily removed. 7. Once all of the samples are lo aded , the amplification program will be started. It will take app roximately 120 minutes for 35 cycles. 29 8. The PCR machine is programmed to drop to a temperature of 4C at the end of the run and to hold this temperature. The tubes will be removed and stored a t –20 C until needed in S tep 3. Step 3. Agarose electrophor esis of ampl ified DNA Materials: 2 X 20 -well 2% agarose gel prepared with Tris -borate -EDTA (TBE) buffer containing 0.5 g/ml ethidium bromid e; TBE running buffer. 1. Because the products of the PCR reaction are expected to be between 450 bp and 750 bp, in order to distinguish the fragment sizes a concentrated agarose gel is required. A 2% agarose gel prepared in Tris -borate EDTA buffer ha s be en prepared for the class’s use by dissolving 2 grams of agarose in 100 ml of the buffer. The ethidium bromide was added to the molten agarose so that staining and destaining are not required. 2. Place the gel tray and gel into an electrophoresis tank a nd add TBE buffer until the gel is submerged by about 1.5 mm. 3. Tap the P CR tube to mix up the contents. Pipe tte 15 µl fr om your PCR reaction tube into a 1.5 ml microfuge tube and add 3 µl of Tracking Dye (bromophenol blue 0.5%, glycerol 50%). Vortex the t ube fo r 2 seconds then centrifuge at top speed for 10 seconds. 4. Pipette 18 µl of each of your PCR sample s int o one of the wells of the gel. Make sure to record the location of your sample on the sign up sheet next to the electrophoresis tank. 5. The Instructo r will make up and load a DNA standard containing 1.0 µg of 50 bp ladde r (Roche) in a volume of 15 µl ddH2O with 3 µl Tr acking Dye added. 6. Put the lid on the electrophoresis tank; plug the leads into the power pack; set the voltage to 150 and the timer to 5 0 minu tes and press RUN . 7. The Instructor will take a photograph of the g el and post it on Nexus under the Lab 5 Module . You will be analyzing the gels f or BOTH lab sections (Monday and Tuesday) together as one sample size for the formal report . The PCR ex ercise i s writ ten up as a formal lab report that will be due by 11:59 PM on Wed , March 17 th. Th e Lab 5 module on Nexus include s the s pecific guidelines for the report . The following four r eferences can be accessed using the R eserveReadings tab on our lab Nexus site. Deka, R., S. DeCroo, L. Jin, S. T. McGarvey, F. Rothhammer, R.E. Ferrell & R. Chakraborty. 1994. Population genetic characteristics of the D1S80 locus in seven human populations. Human Genetics 94 : 252 -258. Koseler, A. , A. Atalay, E.O. Ata lay. 2009. Allele Frequency of VNTR Locus D1S80 Observed in Deni zli Province of Turkey. Biochemistry Genetics 47 : 540 -546. Sajantila, A., B. Budowle, M. Strom, V. Johnsson, M. Lukka, L. Peltonen & C. Enholm. 1992. PCR amplification of alleles at the D1S80 locus: comparison of a Finnish and a North American Caucasian sample, and forensic case work evaluation. American Journal of Human Genetics 50 : 816 -825. Verbenko, D. A., P.A. Slominsky, V. A. Spitsyn, N.A Bebyakova, E.K. Khusnutdinova, A.I. Mikulic h, L.A. T arskaia, M.V. Sorensen, V.P. Ivanov, L.V. Bets, S.A. Limorska. 2006. Polymorphisms at lo cus D1S80 and other hypervariable regions in the analysis of Eastern European ethnic group relationships. Annals of Human Biology 33(5/6): 570 -584. 30 Lab 6 Module – Transf ormatio n of Yeast with the Plasmid pRY121 A large number of yeast plasmids, known as shuttle v ectors, have been constructed so that they can be propagated in both E. coli and Saccharomyces cerevisiae. These p lasmids contain an origin of replication, which can fu nction in E. coli , and one or more genes for antibiotic resistance that contain unique c loning s ites (i.e. there is a recognition site for a specific restriction enzyme within the antibiotic resistance gene and there are no other recognition sites f or this enzyme within the plasmid). The antibiotic resistance genes are used to select for the presence of the plasmid in E. coli . These plasmids also contain either the replication origin from the yeast 2 µm plasmid (a naturally occurring yeast plasmid) o r an au tonomous replicating sequence ( ARS ) from a yeast chromosome. The ARS allows the plasmid to repli cate in the yeast nucleus. Finally, these plasmids contain one or more wild type yeast genes that allow fo r their selection after transformation of a sui table y east auxotroph . The plasmids are lost from the transformed yeast cells if selection for the wild type gene is not maintained. Plasmids containing a yeast centromere are more stable and are more likely to be maintained in the absence of selection th an are plasmids possessing the 2 µm origin of replication. The plasmid pRY121 contains the ori and ampR sequences from the E.coli plasmid known as pBR322, the yeast 2 µm plasmid replication origin, the wild ty pe URA3 gene from yeast (cloned into the Hin dII I site of the TetR gene of the pBR322 plasmid) and the promoter region for the yeast GAL - 1/GAL -10 genes fused to the lac Z gene from E. coli . The plasmid is maintained in E. coli strain DH5 α. Figure 5 -- Plasmid pRY121 This plasmid co nstruct ion illustrates the use of reporter genes to study the expression and regulation of gene tic regi ons or sequences. The gene for β-galactosidase is from E.coli and it is the reporter gene. This gene sequ ence is fused, in the correct reading frame, to a regu latory region of interest that is difficult to characterize . In this case the Gal1/10 promoter o f yeast is being studied and the presence of β-galactosidase activity in yeast cells possessing the plasmi d is indicative of promoter activity, because yeast do not synthesize this enzyme. In this way the promoter can be indirectly URA3 AmpR ori 2 m yeast origin Gal1/10 promoter – Yeast regulatory region being studied LacZ – Bac terial reporter gene pRY121 plas mid 11.5 kb Fusion of Gal1/10 & Lac Z in correct reading frame 31 characterized by monitor ing β-galactosidase activity under various metabolic conditions. In strains transformed with pRY121 the ex pression of the lac Z gene is controlled by the galact ose regulatory system of yeast. The promoter is induced by galactose and subject to c ata bolite r epression by glucose. The enzyme is assayed by the hydrolysis of ONPG (ortho -nitrophenyl -β-D-galactoside) producing a bright yellow chromophore, ONP (or tho -nit ro -phenol). The production of ONP can be monitored using the spectrophotometer. There are a v ariety of methods used to transform yeast. The first to be reported involved converting the cells to proto plasts by enzymatic digestion of the cell wall and the n treating them with plasmid DNA in the presence of calcium chloride and polyethylene gl ycol (PE G). The protoplasted cells are very fragile and have to be osmotically stabilized by the inclusion of 1 M sorbitol in the medium and solutions used. Anot her met hod uses lithium acetate (LiAc) to make the cells competent. They are then transformed by plasm id DNA in the presence of PEG. The PEG precipitates the DNA onto the cell surface. We shall use a variant of the lithium acetate procedure which uses sin gle str anded salmon DNA as a “carrier” for the plasmid DNA. This is designed to improve the tra nsformat ion efficiency and increases in efficiency up to1000 -fold have been reported using this methodology . There are 5 steps to this procedure . Note – you ar e not p erforming the actual procedures during the Winter 2021 term Step 1. Isolation of the pl asmid pRY121 from E. coli DH5 α using the PureLink™ Quick Plasmid Miniprep Kit from Invitrogen Materials : Bacterial culture, Resuspension Buffer (R3) , Lysis Buf fer (L7 ), Precipitation Buffer (N4) , Wash Buffer (W9) , Wash Buffer (W10) , Spin Column s, Wash Tu bes, Elution Tubes , sterile w ater. 1. Work with another group throughout this procedure so that the microfuge tubes will be balanced whenever you are microfuging. 2. Pipette 1.5 ml of the bacterial strain carrying the pRY121 pl asmid into a labeled 1.5 ml microc entrifuge tube and centrifuge at top speed for 30 seconds. 3. Remove all of the supernatant with a micropipette. Use a small volume micropipette to remove the las t drop! 4. Resuspend the cell pellet in 250 µl of Resuspension B uffer ( R3 ) by vortexing vigorously . No cell clumps should remain. 5. Add 250 µl of Lysis Buffer ( L7 ) and mix gently by inverting the tube 5 times. Do not vortex. 6. Incubate the tube at room temperatu re for 4 minutes. DO NOT EXCEED 5 minutes. The solution sho uld become viscous and clear. 7. Add 350 µl of Precipit ation Buffer ( N4 ). Mix gently by inverting the tube until the solution is homogeneous (8 -10 times should be adequate). Do not vortex . A visi ble whi te precipitate will become visible. 8. Microcentrifuge at top speed for 10 minutes. A compa ct white pellet of debris (bacterial proteins and chromosomal DNA) will form on the bottom/side of the tube. The supernatant contains the plasmid DNA. (You want to KEEP the liquid !!) 9. Label a Spin Column and place it into a labeled Wash tube (2.0 ml). (Reme mber that the Wash tubes are different from the regular microfuge tubes.) 10. Pipette the supernatant (from step #8) into the labeled Spin Column/Wash Tube. 11. Centri fuge th e Spin Column + Wash tube at top speed for 1 minute. 32 12. Remove the Spin Column from its Was h tube and discard the filtrate from the Wash tube (the plasmid DNA is adsorbed onto the Column). Replace the Spin Column in its Wash tube. 13. Pipette 500 µl of Was h Buffe r ( W10 ) into the Spin Column and incubate at room temp erature for 1 minute. Centrifuge the Spin Column + Wash tube at top speed for 1 minute. 14. Remove the Spin Column from its Wash tube and discard the filtrate from the Wash tube (the plasmid DNA is still a dsorbed onto the Column). Replace the Spin Column in i ts Wash tube. 15. Pipette 700 µl of Wa sh Buffer ( W9 ) int o the Spin Column and centrifuge the Spin Column + Wash tube at top speed for 1 minute. 16. Discard the filtrate from the tube; replace the Spin Co lumn in to its Wash Tube and microfuge at top speed for 1 minu te. This will remove all traces of the Wash Buffer, which contains 50% ethanol. 17. Remove the Spin Column and place it in fresh sterile labeled 1.5 ml Elution Tube. Discard the Wash Tube. 18. Pipette 10 0 µl of sterile water onto the center of the Spin Column. Lea ve the tube at room temperature fo r 1minute and then elute the plasmid DNA by centrifuging at top speed for 2 minute. 19. Discard the Spin Column. The Elution Tube should contain about 4 0 ng/µl of plasm id DNA. 20. To determine exactly how many ng of plasmi d DNA you r sample has per µl, take your sample over to the NanoDrop ™ spectrophot ometer and fill in the table below. See page s 14 -17 of the lab manual for operating instructions for the NanoDro p™ spec trophot ometer. Make sure to vortex your samples before loading them in the NanoDrop ™ spectropho tometer. Re covery Tube 260/23 0 Ratio Concentration of Plasmid DNA (ng/µl) Amount of µl that would contain 200 ng of Plasmid DNA needed in Yeast Exercis e 2 PR Y121 Re covery Tube Example Tube 1.8 40 ng/µl 200 ng = 5.0 µl 40 ng /µl 21. Freeze the labeled pla smid preparation at -20 C until needed. Step 2. Transformation of Yeast Strain DY2389 with pRY121 In preparation for transformation a cultu re of y east is grown overnight at 30°C on a plate of Yeast Pep tone Dextrose medium plus adenine (YPAD) . A loop ful of cells (approx. 10 8cells) from the overnight culture is resuspended in 10 ml of pre -warmed double strength YPAD and grown on a shaking incub ator fo r 4 hou rs. The cells divide twice in this time. The cel ls are harvested and washed in sterile water. Th e water is removed and the cells are resuspended in Transformation Mix (single stranded carrier DNA, plasmid DNA, 1.0 M LiAc and PEG, molecular we ight 35 00, 50% w/v) and the mixture incubated at 42°C for 40 m inutes. The cells are pelleted, resuspen ded in s terile water and plated on selective medium. The auxotrophic yeast strain DY2389 has the genotype trp1 his3 ura3 lys2 ade2.1 . We shall select for the URA 3 gene carried by pRY121 by plating transformed cells o nto medium lacking uracil. 33 Materials: DY2389 - 10 ml culture at approximately 4 x 10 7 cells/ml; LiAc - 1.0 M LiAc, pH 8.9; pRY121 (≈40ng /µ l) in sterile water; single stranded salmon sperm carrier DNA (SS DNA), 2 mg/ml, boiled and chilled in ice water; PEG - Polyethylene glycol MW 3350, 50% w/v in water; 5 Plates of Synthetic Complete Medium minus Uracil (SC -URA); 1 plate of YPAD 1. The cell density of the DY2389 culture for the Winter 2021 term was 3.58 x 10 7 cells/ml. This information will be required when the transformation efficiency is calculated. 2. Since we want 4 x 10 7 cells in each of our treatments, we will t ransfer five 1.12 ml aliquots of DY2389 into microfuge tubes and microfug e for 1 minute to pellet the cells. Discard the supernatant. 3. Resuspend the cells in 1.0 ml sterile water by vortexing vigorously then microfuge for 1 minute to pellet the cells again. Discard the supernat ant. 4. Repeat this wash once more by resuspending the cells in 1.0 ml sterile water by vortexing vigorously then microfuge for 1 minute to pellet the cells one last time . Discard the supernatant and make sure to remove the final minute amounts of water wit h a micropipette. 5. Label the tubes: Control , Normal , No Car rier , No PEG and No HS . 6. Add the various components of the transformation mix using the following chart. Before you begin, fill in the plasmid column with the amount of plasmid that will be added to 4 of the tubes based on your calculations found in the tab le on page 3 2. You’ll also need to add in the volume of water needed so that each tube has a final volume of 360 µl. Once your table is fully filled in, begin by adding the water to each of your t ubes and then add the remaining components in order from l eft to right. Vortex after each addition to insure thorough mixing. Be careful! You are not adding every ingredient to each tube!! Tube Name Water ( l) To bring total volume to 360 µl SS DNA ( l) Plasmid pRY121 ( l) needed to add 200 ng of plasm id DNA 1.0 M LiAc ( l) PEG ( l) Control 58 26 0 36 240 Normal 26 36 240 No Carrier 0 36 240 No PEG 26 36 0 No HS 26 36 240 7. Vortex all five tubes vigorously after the addition of the PEG. 8. Incubate the Control , Normal , No Carrier , No PEG tube s at 42 °C for 40 minutes. Keep the No HS tub e in ice/water during this time at your bench. 9. 100 µl of e ach of the five tests will be plated onto SC -URA medium . Label the 5 plates of SC - URA with the appropri ate tube name . 10. Microfuge all of the tubes for 30 se conds and remove the supernatants with a micropipette. 11. Add 500 µl water to each tube and resuspend the cells by vortexing vigorously . 12. Vortex each tube before plating samples 100 µl from each tube onto the labeled plates of SC - URA. 13. Aseptically spread the sa mples evenly over the agar surface. 14. Streak a loopful of cells (4 way streak) from the Control tube onto the plate of YPAD to allow the isolation of normal (i.e. non -transf ormed ) single colonies. 34 15. The plates will be covered and incubated at 30°C for 2 or 3 days and then refrigerate d until needed. The number of URA 3 transformants for each treat ment plated will be recorded from the Lab 6 data file within the Lab 6 Module . T ransformation efficiencies will then be calculated for each treatment . Step 3. Isolation of URA3 Transformants Materials: Plates of SC -URA and YP D 1. Subculture one DY2389/pRY121 transformant from one of the Normal transformation plates onto a plate of SC -URA. Subculture one colony of DY23 89 from the streak plati ng of the Control tube onto the plate of Y PD. 2. These cultures will be incubated at 30 °C f or 2 days and will be used as a source of control and transformed DY2389 for the rest of the experiment. Step 4. Inoculation of Yeast Strai ns in to Galactose and Glucose media Control DY2389 and the DY2389/pRY121 transformed strain can now be grown in mediu m containing either glucose or galactose and tested for the induction of the lacZ gene carried by the plasmid. The cultures are grown in SD med ium (synthetic complete m edium supplemented with casein hydrolysate and peptone) containing either glucos e or gal actose for fermentation. Materials: Large size test tubes containing 10 ml of the following media: SD minus URA + Glucose medium SD min us U RA + Galactose medium SD plus URA + Glucose medium SD plus URA + Galactose medium 1. The first step in characterizing the gal1/10 promoter is to grow the control and transformed DY2389 strains in medium containing different sugars. An inoculum of 10 6 ce lls in approximately 10 µl is to be added to each of the culture tubes. The following procedure i s used t o obtain the desired cell suspensions. 2. Pipette exactly 1.0 ml of sterile water into two microfuge tubes and three spectrophotometer cuvettes. Label o ne mi crofuge tube DY2389 and the other DY2389/pRY121. 3. Aseptically prepare a heavy suspension of DY 2389 fro m the Y PD plate in the water in the labeled microfuge tube and vortex vigorously . P ipette 10 µl of this suspension into one of the spectrophotometer cuv ettes. How much is the sa mple in the cuvette diluted compared to the original suspension? 4. Mix the cont ents in the cuvette by placing a piece of Parafilm TM over the open end of the cuvette and inverting it several times. 5. Determine the OD 545 of the suspe nsi on in the cuvette against a water blank. We are looking for an OD reading between 0.05 -0.15. Given that a suspension containing 1.4 x 10 6 cells/ml has an OD545 of 0.1, calculate the cell density in the cuvette and from this, the cell density of the undilu ted heavy cell suspension. 6. Repeat this entire procedure ( begin ning with step 3) for DY 2389/pRY121 from the SC -URA plate. 7. Use the calculated cell densities for the two strains to determine the volume of each suspension that will contain 10 6 cells. For DY2389/pRY1 21 tran sformed strain For DY2389 contr ol strain 35 8. Obtain 1 tube of each of the four different media. Clearly label e ach t ube with the medium it contains BEFORE you take the tubes back to your bench. 9. The two strains MUST be inoculated into the correct medium in order to characterize the promoter region. Be very ca reful to place the correct strain in the correct medium. 10. Inocul ate 10 6 cells of DY2389 into one tube of SD plus URA + Glucose and one tube of SD plus URA + Galactos e media. Add the strain information to the tube. VORTEX both tubes to mix thoroughly. 11. Inocu late 10 6 cells of DY2389/pRY121 into one tube of SD minus URA + Glucose and one tube of SD minus URA + Galactose media. Add the strain information to the tu be. VOR TEX both tubes to mix thoroughly. 12. Add your initials and the lab day (Monday or Tuesda y) to the label on each tube. The tubes will be covered and refrigerated and then grown in the sh aking in cubator at 30 ◦C at 200 rpm for about 21 hours before they are used in step 5 . Step 5. Assay of β-Galactosidase in Cell -Free Extracts Your cultures s hould h ave grown to approximately 10 7 cells/ml. The cells will be harvested by centrifugati on, washed, resuspended in b uffer and homogenized with glass beads. The resulting cell - free extracts can then be assayed for β-galactosidase activity using the ONPG as the substrate and measuring the production of the yellow chromophore ONP in the spectrop hotometer. Materials: Homo genization buffer (Z buffer); Glass beads, 0.45 mm diameter, acid washed; ONPG; 0.1 M Sodium carbonate 1. Pour each culture into a 15 ml pl astic t ube; transfer all label information as you do so. 2. Centrifuge in the benc h top centri fuge for 5 min at 3500 rpms . 3. Label 4 microfuge tubes on the SIDE of the tube – one for each strain & media combination. 4. Discard the supernatant and r esuspend each ce ll pell et in 1.0 ml Z buffer by vortexing vigorously. Transfer the suspensions to labeled microfuge tubes. 5. Microfuge fo r 10 seconds, remove the supernatant and resuspend the cells in 500 µl Z buffer. The cells MUST be completely resuspended BEFORE proceed ing to the next step. 6. Add 500 µl glass beads, cap the tubes securely . Be sure NOT to have any beads caught between the lid and the top of the microfuge tube or your sample will leak out. V ortex them at top speed, upside down , for 4 periods of 30 seconds, coolin g them on ice for at least 30 seconds between vortexings. 7. Microfuge the homogenates at top speed for 3 minutes . Label 4 clean microfuge tubes with the strain and medium information. After microcentrifugation, transfer the cell free supernatants to the fresh, labeled microfuge tubes and keep those 4 tubes on ice. 8. Label anothe r set of 4 new microfuge tubes with the strain and medium information. These will serve as your Enzyme Reaction Tubes . Add 100 µl of Z buffer and 20 µl of ONPG to each of the se 4 tube s. 9. You are now ready to assay the relative amounts of β -galactosidase ac tivity in the 4 cell -free extracts currently on ice . At 30 second intervals, add 50 µl of the appropriate cell extract from the tube on ice to the appropriate ly labeled Enzyme Reactio n Tube . Vortex each tube briefly to mix and place in the 37 C heating block immediately. 10. Incubate each tube at 37°C for exactly 15 minutes and terminate the reaction by adding 1.0 ml 0.1 M sodium carbonate. 36 11. Prepare a spectrophotometric blank consist ing of 150 µl Z buffer, 20 µl ONPG and 1.0 ml sodium carbonate. 12. Read the absorbance of each sample at 420 nm against t he blank. The colour and absorbance readings of the four samples can be found in Tab le 3 of the Lab 6 assignment. The Lab 6 Assign ment found un de r the Lab 6 Module is due by 11:59 PM on Wed, Marc h 24 th. References available under ReserveReadings tab on lab Nexus site: Gietz, R.D. and R.A . Woods. 2001. Genetics transfor mation of yeast. BioTechniques 30 :816 -831. Gietz, R.D. and R.A. Woods. 2002 . Transformation of Yeast by the Liac/Ss Carrier DNA/PEG Method. Met hods in Enzymology 350 : 87 -96. 37 Lab 7 Module – The Lac tose Operon of E. coli The genetic control of metabolism was first studied in prokaryotes, especial ly E. coli , and it has been established that much of the genome of prokaryotes is org anized into u nits of co -ordinate expressio n or operons . The best -studied system is the lac operon of E. coli , which is involved in the metabolism of lactose. The structure of the lac operon is shown below: I - repressor gene codes for a repressor prote in which bind s to the Ope rator r egion turn ing off the entire operon in the absence of lactose . Pro - promoter binding site for RNA polymerase. O - operator binding site o f the repressor protein. When the repressor is bound to the operator , RNA polymerase cannot transc ribe the gen es of t he operon. When l actose is present in the environment, it will bind to the repressor protein , inactivating it and preventing it from bindin g to the operator. Z - structural gene for β-galactosidase . The enzyme hydrolyses β-galactosides in general and speci fically hy drolyz es lactose to glucose + galactose. Y - structural gene for β-galactoside permease . The protein transports lactose and other β- galactosides across the cell membrane. A - structural gene for galactoside transa cetylase . The in vivo function o f this enz yme has not been definitely established. IPTG (isopropyl -β-D-thiogalactoside) is an inducer of the operon since it will bind to the repressor protein inactivating it, but it is not a substrate for the enzyme β-gal actosidase. IPTG is transported across the membrane by the β-galactoside permease but is also able to enter cells without the activity of the permease. ONPG (ortho -nitrophenyl -β-D-galactoside) is a substrate for β-galactosidase but does not induce the synt hesis of the enzyme because the repressor protein has a very low affinity for this molecule. This study of the lac operon involves following the induction characteristics of 4 bacterial strains that possess differ ent genotypes at the lac operon. The genot ypes and phenotypes observed on EMB lactos e agar of the 4 strains are listed below. EMB stands for eosin yellow, methylene blue and is an indicator plate that distinguishes between strains that can ferment the suga r present in the medium (lactose in this s ituation) and those that cannot ferment th e sugar. Strains that can ferment lactose are phenotypically lac + and those that cannot ferment lactose are phenotypically lac -. NOTE : There is ONLY one genotype that is c onsidered lac+ and that is when ALL operon components are wild type or “+” (i.e. lac + Z+ Y+ I+). A phenotype of lac+ simply means that lactose can be metabolized or that Lac Z + and Lac Y + are present in the genotype. Genotype Phenotype lac+ Z+ Y+I+ lac+ lac - Z- Y+I+ lac - lac - Z+ Y+I- lac+ lac - Z+ Y-I+ lac - lacI + Pro lac O+ lac A+ lac Y+ lac Z+ 38 The experiment is divided into two main parts: Note – you are not per forming the actual procedures during the Winter 2021 term Step 1. Induction of β-galactosidase activity Each of the four strains is treated with I PTG to induce the synthesis of β-galac tosidase, and with water as a control. Samples are taken at zero, 20 and 40 minutes after induction and pipetted into microfuge tubes containing chloroform. The chloroform make s the cell envelope permeable, kills the cells and prevents further enzym e synth esis. This allows us to determine the amount of enzyme in the cells at the three time points in the presence of the strong inducer and under control, or non -induced conditions. Step 2. Assay of β-galactosidase activit y Β-galactosidase activity is a ssayed using ONPG as the substrate. ONPG (a colourless molecule) is hydrolyzed by β-galactosidase to the yellow chromophore ONP. The reaction is terminated and the color maximized by the addition of 0.1 M Na 2CO 3 to the assay mix. The relative amount of ONP present in the tubes is determined by measuring the Absorbance 420 with a spectrophotom eter and the absorbance reading is a measure of the β-galactosidase activity in the samples. The more enzyme that is present in a tube, th e more hydrolysis of ONPG that will occur and the higher the absorbance reading will be. Step 1. Observation of EMB Phenotypes & Induction of β-galactosidase activity Materials: Log phase cultures of strains A, B, C, and D gro wing in DAB broth; IPTG; ON PG; 0.1 M Na 2CO 3, chloroform. The timing in this experiment is complex. Read the instructions below and draw up a plan for the experiment before you start. 1. Prepare your INDUCTION TUBES. Label four tubes with the 4 s trai ns A, B, C and D plus the identifi er IPTG . The cells in these tub es will be induced LATER with IPTG. Label four other tubes with the 4 strains A, B, C and D plus the identifier WATER . The cells in these tubes will be induced LATER with water. 2. Mix eac h ba cterial cul ture thoroughly before sampling to insure that you sam ple from a homogenous suspension. 3. Pipette 1.0 ml of Strain A into each of the Strain A labeled INDUCTION TUBES . Repeat this procedure for Strains B, C, and D to give a total of 8 INDUCTIO N TU BES. 4. Place all INDUCTION TUBES in a heating block at 37°C and KEE P them in the heating block at all times except when sampling. Note: the INDUCTION TUBES have yet to be induced with IPTG or water at this time! Thi s will happen LATER on in step 8 of t he experiment. 5. Label 24 microfuge tube s that will serve as your S AM PL E tubes . An example of a label is “A - W -20” and the labeling is completed as follows: - Label 6 tubes A (for strain A), 6 as B, 6 as C and 6 as D making 4 sets of 6 tubes. - For each set of 6 tubes from above, label 3 with “W ” for H 2O and label 3 with “I” for IPTG making 8 sets of 3 tubes. - For each of the above 8 sets of tubes label one tube “ 0” (for sampling time at 0 minutes) , “20 ” (20 minute sample) and “40” ( 40 minute sample ). 39 6. Add 1 0 µl of chlorof orm to the time 0 sampl e tubes ONLY . Cap the sample t ubes tightly so that the chloroform will not evaporate. NOTE: You are NOT adding chloroform to the time 20 and time 40 sample tubes at this time. There will be time to do this LATER as out lined in th e table on page 41 . 7. You are now ready to begin the ind uction and sampling phases of the experiment. Use the table on page 4 1 to assist you. REMEMBER that the timing is very important in this experiment and you want each tube to be incubated with its induce r for exactly 0, 20 and 40 minutes at the time of the sampling. Use a stopwatch during this phase of the experiment. 8. The specific procedures to be used for induction and sampling are as follows : a) INDUCTION PROCEDURE - ADD 75 µl of the a ppro priate indu cer, either water or IP TG to the appropriate INDUCTION tube in the heating block . - Vortex briefly and immediately remove the TIME 0 SAMPLE using the procedure below. b) SAMPLING PROCEDURE - This procedure is used at all three sampling ti mes: - Vortex t he INDUCTION TUBE brief ly. - REMOVE 100 µl from an IND UCTION tube and place it in the appropriate SAMPLE tube that already contains 10 µl of chloroform. Cap the SAMPLE tube tightly. - VORTEX the SAMPLE tube strongly to allow the chloroform t o di srupt the c ells. - Return inductio n tube to the heating block . Sa mple tube can be left at room temperature. 9. Use the chart on page 4 1 to help with the timing in this experiment and make sure that you understand everything that you need to do BEFORE you beg in. 10. Freeze the 24 SAMPLE tubes at -20 C until next week when the assay of enzyme activity will be performed. The induction tubes are discarded in the biohazard bag. 11. Before leaving the lab, e xamine the EMB lactose agar plates that have been inoculated w ith the strains A, B, C and D. Record their phenotypes as lac+ (colon ies that grew dark green so metimes with a metallic sheen) or lac - (colonies that grew white ). Step 2. Assay of β-galactosidase activity Β-galactosidase activity is now assayed using ONPG as the substrate. ONPG is hydrolyzed to the yellow chromophore ONP and the color is measured at 420 nm using a spectrophotometer. Since we are using the intensity of the yellow co lor as a direct indication of the amount of enzyme present, all variables that can affect the amount of ONP produced by a fixed amount of enzyme must be controlled. The variables that must be controlled are: volume of ONPG solution added, the temperature o f incubation and the duration of incubation. These variables must be the same for all samples for your results to be reliable. 1. Thaw all 24 sample tubes prepared last week and place all tubes in the 37 C heating block . All tubes will receive 20 µl of ONPG, will be incubated for exactly 15 minutes at 37 C and will have the enzyme reaction terminated by the addition of Na 2CO 3. You can add the ONPG to the tubes in any order (a specific order is suggested below, but you can use whatever order you wo uld like) as long as you add the Na 2CO 3 to the tubes in exactly the same order. Use a stopwatch to insure precise timing of your enzyme assays. 40 2. At Time Zero remove the A-W -0 tube from the heating block , vortex, add 20 µl of the ONPG solution, vortex again and return t he tube to the heating block . 3. At Time 30 seconds remove the B-W -0 tube from the heating block , vortex, add 20 µl of the ONPG solution, vortex again and return the tube to the heating block . 4. At 60 seconds remove the C-W -0 tube from the heating b lock , vortex , add 20 µl of the ONPG solution, vortex again and return the tube to the heating block . 5. Continue to add ONPG to the remaining tubes at 30 seconds intervals. 6. At 15 minutes add 1.0 ml of the 0.1 M Na 2CO 3 solution to the “A -W -0” tube and vortex. Na 2CO 3 termi nates the enzyme reaction and maximizes the yellow color . The tube can now be left at room temperature. 7. At 15 minutes 30 seconds add 1.0 ml of the 0.1 M Na 2CO 3 solution to the “B -W -0” tube and vortex. 8. Continue at 30 seconds intervals until all you have add ed Na 2CO 3 to all 24 tubes. 9. M icrofuge the tubes at top speed for 5 minutes to sediment the cellular debris. 10. Prepare a blank for the spectrophotometer by adding 20 µl ONPG to 1.0 ml of 0.1 M Na 2CO 3. 11. In the table below record the color of each s ample as color less (C), pale yellow (PY), yellow (Y) or bright yellow (BY) as you prepare to measure the Absorbance 420 of each sample against the blank. Very carefully pipette 1.0 ml (use the P1000 micropipette) of each sample into a 1.5 ml cuvette. Make sur e that you d o not disturb the pellet of cellular debris. Record your absorbance value s in the table found below. 12. Rinse the sample cuvettes with distilled water between readings , especially when going from a bright yellow to a pale yellow sample. Color – can be found in table 2 of the Lab 7 assignment Strain A Strai n B Strain C Strain D TIME IPTG WATER IPTG WATER IPTG WATER IPTG WATER 0 20 40 Absorbance at 420 nm – Can be found in tab le 3 of the Lab 7 assignment Strain A Strain B Stra in C Strain D TIME IPTG WATER IPTG WATER IPTG WATER IPTG WATER 0 20 40 The Lab 7 Assign ment found unde r the Lab 7 Module is due by 11:59 PM on Wed, March 31 st. 41 EX. 1 Timeline for Induction of β-galactosidase activity in E.coli Strains TIME TUBE(S) ACTION REQUIRED Step 6 top of page 39 TIME 0 SAMPLE TUBES (8 TUBES) Add 10 l of chloroform to each sample tube & cap tightly 0 minute A WATER INDUCTION TUBE & A – W – 0 SAMPLE TUBE INDUCTION & SAM PL ING procedures 1 minute B WATER INDUCTION TUBE & B – W – 0 SAMPLE TUBE INDUCTION & SAMPLING procedures 2 minutes C WATER INDUCTION TUBE & C – W – 0 SAMPLE TUBE INDUC TION & SAMPLING procedures 3 minutes D WATER INDUCTION TUBE & D – W – 0 SAMPLE TUBE INDUCTION & SAMPLING procedures 4 minutes A IPTG INDUCTION TUBE & A – I – 0 SAMPLE TUBE INDUCTION & SAMPLING procedures 5 minutes B IPTG INDUCTION TUBE & B – I – 0 SA MPLE TUBE INDUCTION & SAMPLING procedures 6 minutes C IPTG INDUCTION TUBE & C – I – 0 SAMPLE TUBE INDUCTION & SAMPLING procedures 7 minutes D IPTG INDUCTION TUBE & D – I – 0 SAMPLE TUBE INDUCTION & SAMPLING procedures 17 minutes TIME 20 SAMPLE TUBES ( 8 TUBES) Add 10 l of chloroform to each sample tube & cap tightly 20 minutes A WATE R INDUCTION TUBE & A – W – 20 SAMPLE TUBE SAMPLING procedures 21 minutes B WATER INDUCTION TUBE & B – W – 20 SAMPLE TUBE SAMPLING procedures 22 minutes C WATER INDUCTI ON TUBE & C – W – 20 SAMPLE TUBE SAMPLING procedures 23 minutes D WATER INDUCTION T UB E & D – W – 20 SAMPLE TUBE SAMPLING procedures 24 minutes A IPTG INDUCTION TUBE & A – I – 20 SAMPLE TUBE SAMPLING procedures 25 minutes B IPTG INDUCTION TUBE & B – I – 20 SAMPLE TUBE SAMPLING procedures 26 minutes C IPTG INDUCTION TUBE & C – I – 20 SAMPLE TUBE SAMPLING procedures 27 minutes D IPTG INDUCTION TUBE & D – I – 20 SAMPLE TUBE SAMPLING procedures 37 minutes TIME 4 0 SAMPLE TUBES (8 TUBES) Add 10 l of c hloroform to each sample tube & cap tightly 40 minutes A WATER INDUCTION TUBE & A – W – 40 SAMPLE TUBE SAMPLING procedures 41 minutes B WATER INDUCTION TUBE & B – W – 40 SAMPLE TUBE SAMPLING procedures 42 minutes C WATER INDUCTION TUBE & C – W – 40 SAMPLE TUBE SAMPLING procedures 43 minutes D WATER INDUCTION TUBE & D – W – 40 SAMP LE TUBE SAMPLING procedures 44 minutes A IPTG INDUCTION TUBE & A – I – 40 SAMPLE TUBE SAMPLING procedures 45 minutes B IPTG INDUCTION TUBE & B – I – 40 SAMPLE TUBE SAMPLING procedures 46 minutes C IPTG INDUCTION TUBE & C – I – 40 SAMPLE TUBE SAMPLIN G procedures 47 minutes D IPTG INDUCTION TUBE & D – I – 40 SAMPLE TUBE SAMPLING procedures 42