Homework Archive - 08 December 2017

• Franz Kafka's own sense of social marginalization and alienation is echoed in the interactions between Gregor and his family in the story The Metamorphosis.In which of these excerpts from the story do
• A woman reported feeling "weak in the knees" whenever she smelled cigarette smoke and Beemans gum because of the association of these smells with her...
• What is your understanding of the role of security and privacy in the EA program and in the Enterprise Architecture itself?
• Thousands of new products are introduced annually and many fail. The annual cost ofproduct failures to US firms can reach about $100 billion.
• A student standing in an empty parking lot throws his calculator at an angle of as measured from the ground, giving it an initial velocity of v0= 6...
• Ethical aspects of marketing in pharmaceutical company
• Machinery Invoice - 190,000 Life of Four years, MACRS 3 year class after obtaining special tax ruling. yr 1 33%, yr 2 45%, yr 3 15% and Ship Charge...
• Ehlena was born with cerebral palsy, a neurological condition that severely limited her mobility.
• The field of applied anthropology developed _______________.
• Write a 1,050- to 1400-word paper on Market Structures and Maximizing Profits. Address the following:
• Suppose that 53% of all registered voters prefer presidential candidate Smith to presidential candidate Jones.
• Explain the role of the inspiratory and expiratory areas of the brain.
• mary weighs 518N and she walks down a flight of stairs 4.m below her starting point.
• A 1.34x10^3 kg car accelerates uniformly from rest to 14.0 m/s in 2/77 s. What is the work done on the car in this time interval?
• The following 4 costs were incurred for Celadon Inc. to acquire and prepare land for a new parking lot: Purchase price of land:
• Which two shifts occur at the end of Franz Kafka’s The Metamorphosis?The first-person narration ends and switches to third person.The point of view goes from a third-person limited to third-person o
• A typical signal sequence in a synchronous connection contains a significant amount of information in addition to just the intended message or data....
• Select the correct line for the following quote quot;the unexamined life is not worth living for menquot;
• Give an example where an executor pool is appropriate. Why are some of the methods in the Thread class deprecated?
• LMN, a manufacturing company, plans to sell 400,000 units of finished product in July and anticipates a growth rate in sales of 4 percent per month.
• sinusoidal voltage v = (100 V) sin (160t) is applied to a series RLC circuit with L = 30 mH, C = 100 F, and R = 44 . (a) What is the impedance of the...
• Which of the following is FALSE regarding a contract made between a French company selling goods to an American company?
• How does grief involving parental reactions to perinatal deaths differ from reactions to other deaths?
• quot;Euromail and Amerimailquot; by Eric Weiner What type of conclusion does Weiner use?
• (4 points) Beginning accumulated depreciation = $137 Ending accumulated depreciation = $291 Depreciation expense during the year = $367 Accumulated
• The Environment Environmental and wildlife preservation ensures future generations will have available resources and can enjoy the beauty of Earth.
• annotated bibliography Quality Measures (Scholarly Review) APA Format (This Class Is Health Care Issues)
• Suppose you bought a call for $2 with an exercise price of $35 and wrote a call for $1 with an exercise price of $40. This strategy is called a.Bull...
• annotated bibliography on Mobile Health (APA Format) This Class Is Health Care Issues
• Christa went shopping for back-to-school clothes. Before the tax was added on, her total was $176. If the sales tax is 6%, what was the total amount she paid? A) $10.56 B) $105.60 C) $126.56 D)
• (Purposes of an External Audit) The Rasmus Company manufactures small gas engines for use on lawnmowers and other power equipment.
• The budget process involves doing all the following except:
• In March 16, 1998, issue of Fortune magazine, the results of a survey of 2,221 MBA students from across the United States conducted by the
• Compare two steps that would be most effective in refining solutions to the problem and resolutions to the issues revolving around media violence.
• Book Value versus Market Value Filer Manufacturing has 8.3 million shares of common stock outstanding. The current share price is $53, and the book...
• assoication of american geographers themes of geography,areas that disply unity refer to
• The Approaches to transnational financial reporting List some of the advantages and disadvantages of each approach which approach do you favor?Why?
• What is the ground-state electron configuration of the chloride ion Cl?
• The most common source of copper (Cu) is the mineral chalcopyrite (CuFeS2). How many kilograms of chalcopyrite must be mined to obtain 395 g of pure
• Calculate the number of moles of solute present in 50.0mg of aqueous solution that is 1.
• For a binomial distribution, the probability of a success stays the same for each trial, but the probability of a failure varies from trial to trial....
• A at circular plate of copper has a radius of 0.182 m and a mass of 25.7 kg. What is the thickness of the plate?
• Adams Corporation manufactures bicycle parts. The company currently has a $21,000 inventory of parts that have become obsolete due to changes in...
• help with outline for my informative speech on history of tattooing in America.
• draw the newman projection for 1R,2R-chloro-1,2-diphenylpropane
• Utech Company bottles and distributes Livit, a diet soft drink. The beverage is sold for 50 cents per 16-ounce bottle to retailers, who charge...
• Calculate the freezing point of a solution that contains 8.0 g of sucrose (C12H22O11) in 100. g of H2O. Kf for H2O = 1.
• I need help with my Zoology 341 class at Oregon state university. How Can I get help
• Typical Corp. reported a deferred tax liability of $6,000,000 for the year ended December 31, 2010, when the tax rate was 40%.
• Of all 3- to 5-year old children, 56% are enrolled in school. If a sample of 500 such children is randomly selected, find the.; Of all 3- to 5-year...
• pfa
• Research New York's wiretapping law. What does it permit? What does it prohibit?
• which expression is equal to (3x^2yz)(5xy^3z^2) answer choices:
• Forms 1120S and 1125-A and Schedule K-1 for advance tax class
• Which of the following statements regarding price level or inflation is correct?
• Is the equation NaOH+C6H8O7 - gt; NaC6H7O7+H2O endothermic ot exothermic?
• The Boyd Bottling Company is contemplating the replacement of one of its bottling machines with a newer and more efficient one.
• the slope of the security market line must be less than the market risk premium
• Choose a research problem associated with the company for which you work that could be explored using OLS regression. Why did you choose regression
• ANSWER the constant of proportionality into the box to match the table. If the table is not proportional, drag and drop "not proportional" into the box. x 2 4 6 8 y 3 7 11 15 A:1/3 B:not proportion
• A skier is pulled up a slope at a constant velocity by a tow bar. The slope is inclined at 26.0 with respect to the horizontal. The force applied to...
• Advantages and disadvantages of matching maturities of assets and liabilities
• Final reflection - What is servant leadership?
• Winona Industries has manufactured prefabricated houses for over 10 years. The houses are constructed in sections to be assembled on customers' lots....
• How can you use your multiple intelligence strengths and learning style to form positive academic habits?
• A heat exchanger is to be designed to condense 1100 kg/hr of steam ay 150 kPa. For this purpose, cooling water at 50 degrees celsius is available in...
• 00 already and you have not told me anything.
• It is desired that a solenoid 37 cm long and with 410 turns produce a magnetic field within it equal to the Earth's magnetic field
• 1)You are a member of an alpine rescue team and must get a box of supplies, with mass 3.0 , up an incline of constant slope angle 30.0 so that it...
• What matters is not the absolute abundance of factors, but their relative abundance. Poor countries have an abundance of labor relative to capital...
• I am doing a lab on quot;Standing Waves on a Stringquot;, and I am supposed to calculate linear mass density quot;u1quot; from the slope of f vs...
• Need to review document Lawn King Inc. Case study. I need solutions to both the questions at the end.) Develop a forecast to use as a basis for...
• After studying the economy, you forecast that there is a 70% chance of a good economy next year and a 30% chance of a poor economy.
• Project for Fossil Smartwatches 2-3 papers as bellow:
• ted Europe's relations with the rest of the world, and how have these relations influenced the development of modern quot;Western Civilizationquot;?...
• Jan 12 oz milkshake 4 oz in the milkshake are vanilla and the rest is chocolate what are the two equivalent fractions that represent the fraction of the milkshake that is vanilla
• What is General health and Specific health?
• Ranns Supply uses a perpetual inventory system. On January 1, its inventory account had a beginning balance of $6,400,000. Ranns engaged in the...
• Look at Kirkpatrick's four levels of evaluation and justify why you would use all these levels even though your boss was interested only in the last...
• What is the kinetic energy of the emitted electrons when cesium is exposed to UV rays of frequency 1.71015Hz?
• ow has media coverage of terrorism and counter-terrorism changed? What role does the media play in counter-terrorism? What role SHOULD the media play?...
• I just need the unlocks for later tbh. I'll 5 star answers tbh.
• (TCO 9) The most common protocol(s) used for sending and retrieving e-mail is(are) _____. Pop and SMTP B. SMTP and Mime C. Mime D.
• Why is the concept of acculturation important to marketers who want to target such groups as Hispanic, Asian or African American consumers?
• Amdahl Corporation manufactures large-scale, high performance computer systems. In a recent annual report, the balance sheet included the following...
• Black pelage of guinea pigs is a dominant trait; white is the recessive trait. When a pure black guinea pig is crossed to a white one, what fraction
• Given the ED50 is 30 and the LD50 is 45, calculate the therapeutic index (TI).
• For this question, see figure 11-35 on page 306 of your textbook. Mass mA = 7.16 kg sits on a frictionless, horizontal surface.
• Background :
• Need a fishbone diagram - The Effect quot;Wrong book received onlinequot; (customer) Causes: computer machine, people, processes, methods.
• Write a one-page (250 words) report on the impact of Big data-as-a-service (Big DaaS) on social media, networks, and surveillance.
• How might dietary supplementation fit into an athlete's comprehensive training and nutrition plan?
• Java Program Test - 2 1. Examine the Item class. Pay close attention to the overloaded constructor and also the display method. Place the Item...
• 1. Consider a Normal Distribution with a mean of 50 and a standard deviation of 10. Using the empirical, what percentage of the data should fall
• 20 points first one to answer is brainlyest The graph shows a proportional relationship between the number of kilometers traveled (y) and the number of minutes spent traveling (x).What is the unit rat
• 1. What are the differences in how bottleneck and non-bottleneck work centers are scheduled under TOC? Why are these differences desirable?
• 11. If the exchange rate between the Mexican Peso and the U.S.$ is 3 Pesos=1$. If this rate changed to 2 Pesos=1$. (a) Are the Mexican exports
• Last year, the U. mean hourly rate was $12. In April of this year, a sample of 50 workers showed an average hourly rate of $13.76 with a standard...
• 30 in a random sample of 100 households in Georgia are TruGreen costumers (Population 1). 25 in a random sample of 100 of households in Florida are...
• calculating the interest rate. in 2008, a gold Morgan dollar minted in 1895 sold for $43,125. for this to have been true, what rate of return did
• The practice of charging fees to advertise on an Internet site is called the
• Structural changes brought on by industrialization in the United States meant that families changed from "grapevine" forms to:
• Read the excerpt below and answer the question. William Zanzinger killed poor Hattie Carroll With a cane that he twirled around his diamond ring finger At a Baltimore hotel society gath'rin' Based on
• Evaluate two to four (2-4) weaknesses that are evident in the selected organization's product life cycle.
• Telecommunications Network Security Plan Project AssignmentThe Acme Corporation is a new startup that wishes to sale their new phone to the public called Ac
• Explain two economic consequences for an individual and two economic consequences for an economy of an increase in its price level.
• Electric charge dives this series of pumps and triggers known as ETS reactions. what is the net effects of these reactions?
• Carys calculates the total amount E, in dollars, that she earns for working h hours using the equation E=10h
• Write a 400-600 word concert report.#origina fulll question uploaded below.
• What term was given to the lessening of tensions between the United States and the Soviet Union during the 1960s and 1970s? A. The United Nations B. Detente C. Perestroika D. The Bipolar Agreement
• You are building a new house on a cartesian plane whose units are measured in miles. Your house is to be located at the point (6,0). Unfortunately, the existing gas line follows the curve y=√16x^2+6
• How do I write a paper on the American Revolution while having to blame America for starting the war?  
• can please someone help me to finish this project I need to put chart or a pie chart for segmentation also targeting be more specific in action budget describes every spend.
• Anthropologists are interested in framing broad hypotheses about human behavior. In order to do this, it is imperative to use examples from multiple cultures to ensure that their conclusions are not g
• 1. For Part 1, describe the changes in the colors of the well, if any, as you go from well 1 to well 9—that is, as you go from the well with the least copper(II) nitrate to the well with the most co
• 1.You are Purchasing and Sales Vice President for a large Texas corporation. The CEO tells you he needs an outline of basic contract law to use for new employees in your division. He will take it to
• A 935 kg drag race car accelerates from rest to 117 km/h in 0.749 s. What change in momentum does the force produce?
• What was one effect of protests such as the one depicted in the photograph? A) President Lyndon Johnson's popularity dropped sharply. B)Congress was motivated to pass the War Powers Resolution. C)Lar
• Sumerians developed many inventions. Choose the invention that you think is the most significant. Number 6
• Our class planned a holiday party for disadvantaged kids. Some of us baked cookies for the party. On the day of the party, we found we could divided the cookies into packets of two, three, four, five,
• Neurobiology, Client Presentation, and Pharmacological Treatment PlansDeveloping appropriate pharmacological treatment plans requires medical and mental health professionals to consider all potential
• Please help, I am very confused!! A wave has a wavelength of 11 mm and a frequency of 17 hertz. What is its speed?
• Describe the purpose of the Counter-Reformation and the circumstances and outcomes of the Council of Trent. Include the role of the Jesuits in your assessment. Conduct independent research, as needed,
• Which sentences use a time-related term correctly? A.Tyler wrote a paper describing life in England in the century, from 1700 to 1799. B. Tyler wrote a paper describing life in England in the century,
• Four students are in the final rounds of a chess tournament, based on their chess rankings, Gloria is twice as likely as Devon to win. Devin is twice as likely as Janet to Win. Janet is just as likely
• Avery works on commission as a car saleswomen.she sold a car today that cost 8,000$ and received a 400$ commission.What percent of her sale is Avery’s commission?
• The beach resort is offering to weekend specials offer a includes a two-night stay with three meals and cost $195 off of be includes the three nights day with five meals and cost $300 find the cost of
• In a different plan for area codes,the first digit could be any number from 0 through 3, the second digit was either 3 or 4, and the third didgit could be any number except 1. With this plan , how man
• A girl makes 12 foul shots for 8 shots that she misses. how many shots did she make if she shot 125 foul shots
• i need help please
• At the end of the story,mallam sile questions the changes in his neighbors attitude towards him as he lies in bed next to his wife .How much does he understand about her role in forcing these changes?
• hello just wanted to know if you can be of help
• No stir in the air, no stir in the sea, the ship was still as she could be;Her sails from heaven received no motion, her keel was steady in the ocean. what is t the rhyme scheme of this stanza
• Helen bit into some imported dark chocolate from Germany. It was incredibly bitter to the taste. What allowed Helen’s brain to register the bitter flavor of the dark chocolate? transduction occurrin
• The title is given to the member of the President's Cabinet who is in charge of diplomatic relations with foreign countries.
• A group of students calculated their average score at a spelling bee.they realized that if one of them scored 9 more points,their average score would be 81 points. If one of them scored 3 points less,
• The distance y (in miles) that a truck travels on xx gallons of gasoline is represented by the equation y=18x
• Match the meaning to the word part. 1. to know cogon 2. to take, seize vert 3. to stand ten, tain 4. to fold nym 5. to lead mis 6. to turn cap 7. to call voc, vok 8. to send sta, sti 9
• A dog eats 7 cans of food in 3 days. At this rate, how many cans of food does the dog eat in 3 + d days? the answer is 7 + 7d/3 but I don't know how to get to that.
• Fabio and Carlos play on a basketball team together. In the last game, Fabio had 7 points less than 2 times as many points as Carlos. Fabio scored 31 points in the game. Write and equation to determin
• The claim is the proportion of peas with yellow pods is equal to 0.25 the sample statistics from one experiment includes 460 peas with 130 of them having yellow pods find the value of the test statist
• A simply supported wood beam of length l = 6 ft carries a concentrated load p at midspan, as shown. the cross-sectional dimensions of the beam are b = 6 in. and h = 11 in. if the allowable shear stren
• Continental __________ fill in volcano __________ fill in plains description low land between hills or mountains ____________ deep valley with high steep sides deepest part of the ocean volcano an
• A population of mammals leaves an ecosystem because of increased temperatures and decreased rainfall. What’s the reason for this shift? change in abiotic factors change in biotic factors change in f
• At what depth, in meters, a column of mercury is the pressure 1.00 atm? the density of mercury is 13.6 × 103 kg/m3.
• A casting director wishes to find one male and one female to cast is his play. If he plans to audition 5 males and 10 females, in how many different ways can this be done?
• Which of the following regions was subject to European imperialism in the 1800s? A. Southeast Asia B. North America C. Mexico D. Russia
• Which sentence has the correct sequence of tenses? Before it became a federal prison, Alcatraz Island serves as the site of a military prison. Before it became a federal prison, Alcatraz Island had se
• A graph of harmonic motion shows that the motion lasted for 10 seconds and it included 5 cycles. What is the period of this harmonic motion?
• An experiment consists of four tosses of a coin. Denoting the outcomes: HHTH,THTT,... and assuming that all 16 outcomes are equally likely, find the probability distribution for the total number of he
• Martin has a gift card to a coffee shop. Each day he buys the same coffee. This table shows the amount remaining in dollars on the gift card on different days. Time (days) 2 4 5 7 Amount remaining ($)
• Given an electron beam whose electrons have kinetic energy of 10.0 kev , what is the minimum wavelength λmin of light radiated by such beam directed head-on into a lead wall? express your answer nume
• How fast (in m/s and mph) would a 6.80-cm copper bar have to move at right angles to a 0.550-t magnetic field to generate 1.50 v (the same as a aa battery) across its ends?
• $825 is divided between A and B. A got 7/15 of the money. How much did A and B get respectively? Please help
• Formula and structure of potassium hydrogen phthalate (KHP) used to standardize the solution of NaOH in this experiment
• If this pulley is subjected to a constant counterclockwise angular acceleration of αa= 3 rad/s2 , determine the angular velocity of pulley b after b turns 5 revolutions. the hub at d is rigidly conne
• Which of the following is a true statement? Only the external media had an impact on the Rwandan genocide. Children may learn aggressive behavior from using the media as a role model. Scholars argue t
• In lab, you performed an experiment with a spring to find the mass of an "unknown mass." if the spring constant is 9.50 n/m and the "unknown mass" caused a displacement of \delta 15.6 cm, what is the
• Watch quot;The beauty I see in algebra: Margot Gerritsen at TEDxStanford.quot; (14 min) https://www.youtube.com/watch?
• Watch quot;Is Math Invented or Discovered Edward Frenkelquot; (6 min) https://www.youtube.com/watch?
• Briefly describe a start-up company (it can be one that you want to start or a realistic fictional one) and the start-up money you would need.
• 2.31 List all pairs (rank(h), nullity(h)) that are possible for linear maps from R5 to R3 . 2.32 Does the dierentiation map d/dx : Pn Pn have an
• epth of the water in the tank is 5ft and is decreasing at the rate of 3 ft/sec, at what rate is the radius of the top surface of the water decreasing?...
• What is the main activity of a producer cooperative? Question 2 options: buying products for its members selling products for its members producing products for its members donating products for its m
• f(x) = x^(2/3) (6-x)^(1/3) Does f(x) have any vertical asymptotes or holes? What kind function is x^(2/3)?
• Point charge is moving at a constant 8.0 x 106 m/s in the + y-direction, relative to a reference frame. at the instant when the point charge is at the origin of this reference frame, what is the magne
• The idea behind workers forming a union to represent their interests is _______________. Question 6 options:
• A business sells computer hardware (H) and software (S). The hardware sells for $70 and the software sells for $50. The total cost of selling these...
• Clarence is the trustee of a trust. With $75,000 of his own money, Clarence purchases a parcel of real estate. Two months later, he sells the parcel...
• hello everyone check out the attachments and make sure the read all the requierments i want to do power point slides along with the project with 12-15 slides
• Question 2 (1 point) The history of labor legislation has consistently been pro-union. Question 2 options:
• Accordingly, XYZ paid ABC for the bulldozer and took delivery on April 12. On April 18, Bank filed a financing statement covering the bulldozers.
• factorial moment generating funtion for uniform distribution
• Travel Coaches currently sells 14,000 motor homes per year at $94,000 each, and 1,500 luxury motor coaches per year at $159,000 each.
• CUFTS ERM Screencast, CUFTS Journal Database Screencast, CUFTS Knowledgebase Screencast, dbWiz Screencast, GODOT Screencast, Citation Manager...
• Search the internet and find an instance of quot;Earnings Mismanagementquot; and quot;Fraudquot;. Tell us: The company name. When they did it. De...
• The Bootsie Holding Company has sales exceeding $10 billion and each of its three, wholly-owned subsidiaries has sales exceeding $2 billion.
• la strategie de ebay englobe acheteur et vendeur au meme temps dans tout les pays du monde,les prix sont toujours fixe et on trouve une multitude de
• The active element of a certain laser is made of a glass rod 33.0 cm long and 1.30 cm in diameter. assume the average coefficient of linear expansion of the glass is equal to 9.00 10-6 (°c)-1. the te
• Your company manufactures nuts (N) and bolts (B). Find the number of nuts and bolts that maximizes profit given the below profit function and
• Gordon, an employee, is provided group term life insurance coverage equal to twice his annual salary of $100,000 per year.
• Examine the most common reasons for not reporting crimes to the police. Discuss how these illustrate social problems or the social responsibility...
• There were some responses that actually represented a complementary use of two frames. This can be illusfrated by a respondentquot;s quote...
• determine the maximum allowable gage pressure inside the shown tank. the tank wall thickness is 0.375 inches.
• 550-750 word essay with 3 references Starting with a quick history background of the cultural identifiers and associated with amending the school
• The development of cyclones and anticyclones about high- and low-pressure regions is a result of deflection of air currents by ____________.
• Question DescriptionQuestions #24-25 (10 points each): You will type out full proofs in the essay box provided. These are regular proofs similar to...
• In the diagram, the radius of the outer circle is 2x cm and the radius of the inside circle is 6 cm. The area of the shaded region is 288π cm^2. Here is what it looks like: https://static.k12.com/nex
• A contract workers had to sign that included a clause that forbade them from joining a union. Question 9 options:
• Part 1: Practical Applications of ANOVAs, Factorial ANOVAs, and ANCOVAs Chapter 6:
• The hoisting gear a has an initial angular velocity of 60 rad>s and a constant deceleration of 1 rad>s2. determine the velocity and deceleration of the block which is being hoisted by the hub on gear
• Design your survey model. Base the objective on a workplace example to identify any loss of support for your organisation development program and...
• SUB-PHYLA: Trilobitomorpha: Myriapoda: Cheliceriformes: Crustacea: Hexapoda: Trilobites (extinct) Centipedes Spiders, scorpions Crustaceans Insects...
• One number is four more times than a second number. Two times the first number is 6 more than four times the second number.
• 7. Schuster P, Lieb R, Lamertz C, Wittchen HU. Is the use of ecstasy and hallucinogens increasing?
• A.adenine B.thymine C.cytosine D.uracil E.guanine 18. Which of the following are paired bases in DNA?
• Fermentation, homolactic, heterolactic, lipase, peptidase, photosynthesis, phototroph. Chemotroph, autotroph, heterotroph, Photoautotroph,...
• 28. differentiate hypotonic, hypertonic and isotonic 29. differentiate simple diffusion, facilitated diffusion active transport and osmosis (i.e.
• Small intestine major function of the intestines What are the functions of intestinal motility? How is intestinal motility controlled?
• Is employment more important than lower consumer goods prices, higher consumer goods quality, and more consumer good variety?
• Do U.S. manufacturers want a strong dollar or a weak dollar? Do U.S. banks want a strong dollar or a weak dollar?
• Which one of the following sentences contains a spelling error? A. Joshua could give no good reason for his absence. B. Evelyn was not familiar with the procedure. C. Every autumn we visit a quaint i
• Chip's Home Brew Whiskey management forecasts that if the firm sells each bottle of Snake-Bite for $20, then the demand for the product will be
• 24 Telephone inquiries of 100 IRS customers are monitored daily at random. Incidents of incorrect information or other non-conformities ( as...
• How do quot;right to workquot; laws operate? Is there evidence that unions are less strong in states with quot;right to workquot; laws?
• Pierre has a utility function for total asset position of u(x)=ln(x), His assets currently consist of $50,000 in cash and a rare violin he inherited...
• 1) Temporary accounts must be closed at the end of the accounting year,True .False 2) The year-end closing entries are also known as year-end...
• Evaluate overall how politicians engaged in the 2008 or 2012 Presidential campaign have integrated their marketing message. Then, evaluate one...
• The ocean, air, and climate could be thought of as a quot; common pool resource .quot; What is a quot;common pool resourcequot;?
• onderful new versions of its iPhones with higher and higher prices, have workers on the assembly lines seen their wages rise? Wouldn't we expect this?...
• The 200-mm-radius disk rolls without sliding on the surface shown. knowing that the distance bg is 160 mm and that at the instant shown the disk has an angular velocity of 8.4 rad/s counterclockwise a
• Utiliscan case analysis Paul, the HR Director at Plastec, had previously worked as Director of HR for Utiliscan, a small company with 240 employees...
• Describe the problems in this Case I - Grandma Studor's Bakery
• find an advertisement for a product that is relatively common such as cosmetics, household goods, or appliances, which is being marketed to a global...
• gather 5 years of monthly data on each of the stocks she has requested, as well as the Samp;P 500 Index. You calculate the average monthly return...
• The signal generator has an open-circuit voltage of 3.5 v. when the generator is loaded with 22 ω resistance, its terminal voltage drops to 2.8 v. what is the generator's output impedance
• Treating the ladder as a uniform rod of length 3.66 m and mass 10.6 kg, find the torque the person must exert on the ladder to give it an angular acceleration of 0.243 rad/s2.
• What does the scene in the throne room tells you about each of the three different friends: Annabella, Grover, and Percy in chapter 19
• Given below are four statements. Some or all may be erroneous (wrong). Rewrite the correct statements after making suitable corrections of the underlined words. (i) (ii) (iii) A cellulose cell wall su
• 2) Thomas Jefferson famously concluded that slavery was like holding a "wolf by the ear . we can neither hold him nor let him go.
• 1)The purpose of the year-end closing process is to bring the temporary accounts to a zero balance.
• 1) In his farewell address, George Washington warned his predecessors over entangling alliances and divisive factions.
• In a sphere-lamp model (where the lamp is the Sun and a sphere is the Moon), and your nose is at the longitude (i., the east-west position) of L.
• You have been painting as long as you can rememberprimarily serene landscapes of mountains, lakes, and streams in watercolor.
• Assuming an interest rate of 12%, the present value of $50,000 to be received 9 years from now would be closest to: $54,000 . $266,400 . $50,000 ....
• Burry Corp acquires 80amp; of bowman co. for $40 million in jan 1st, year 6. At the time of acquisition, bowman has a total net assets with fair...
• What are some impermissible methods of coming to possess or hold things according to Robert Nozick in Distributive Justice?
• What is the difference between Robert Nozick's historical account of justice and a current time-slice view?
• According to Robert Nozick in Distributive Justice, under what conditions would a person be justly entitled to something?
• What is the probability that an electron in the 1s state of a hydrogen atom will be found at a distance less than a/4 from the nucleus?
• Complete the equation of the line through (-10, -7) and (-5, -9). This question is NOT just simple subtraction, it is the slope of the line. So -10-7 or -5,-9 would not be the answer. hint: x2 - x1, y
• Why is management accounting information important? What would happen if this kind of information is not available in a company?
• Read the report below and make judgments on the quality of random sampling for the study, using the scheme outlined above:
• Where qvis is the energy of activation for viscous flow, a is a temperature-independent constant, and r and t are, respectively, the gas constant and the absolute temperature. a plot of ln η versus 1
• Create a table that lists at least four sources of growth in the economy along with two examples of each source.
• In 1493, Pope Alexander VI settled the conflict between Spain and Portugal about their rights to claim the lands they encountered during their explorations. Explain why the pope settled the argument,
• A study of commuting times reports the travel times to work of a random sample of 20 employed adults in New York State. The mean is x = 31.25 minutes...
• A galvanic cell consists of a mg electrode in a 1.0 m mg(no3 )2 solution and a ag electrode in a 1.0 m agno3 solution. calculate the standard emf of this cell at 25°c
• Dermavescent Labs Case The information below is transcribed from WS#1 of the above case: Unit contribution margin = 78.9% Brand contribution margin...
• A rectangular garden has length twice as great as its width. A second rectangular garden has the same width as the first garden and length that is 4 meters greater than the length of the first garden.
• Discuss the role of the distribution channel within an organization. Most organizations utilize multiple distribution channels to distribute their...
• Calculating Net Float each business day, on average, a company writes checks totaling $14,400 to pay its suppliers. The usual clearing time for the...
• Identify the type of sequence of these two graphs. a) geometric sequence b) arithmetic sequence c) neither
• How much energy (in kj) is released by the combustion of 13.50 kilograms of propane in sufficient oxygen?
• Chapter 9, Section 2, Exercise 030 Use the following ANOVA table for regression to answer the questions. Response: Y SourceDFSum SqMean...
• Part aconsider these hypothetical chemical reactions:a⇌b,δg= 14.3 kj/molb⇌c,δg= -28.2 kj/molc⇌d,δg= 9.00 kj/molwhat is the free energy, δg, for the overall reaction, a⇌d?
• Which sentence contains a phrase that requires a hyphen? A) We yelled during the entire soccer game. B) The weather was unseasonably warm on Saturday. C) Our new governor elect was once a football pla
• What is the solubility of marble (i.e., [ca2+] in a saturated solution) in acid rainwater, for which ph=4.20?'?
• What problems does an assembler have to overcome in order to produce complete binary code in one pass over the source file?
• A container contains 12 diesel engines. the company chooses 6 engines at​ random, and will not ship the container if any of the engines chosen are defective. find the probability that a container wi
• Suppose you push integer elements 1,2,3,4 onto a stack in that order. then pop an element off the stack and add that element to a queue. you repeat that process three more times. in what order will yo
• An error is made in solving the equation below. What is the correct solution to the equation. 3(x – 3) = 12 3(x – 3 + 3) = 12 + 3 3x = 15 x = 5 A.1 B.7 C.9 D.21
• Write an inequality to solve the following problem. Lydee signed up for dance lessons. The Ballet Company charges a registration fee of $45, plus $60 per month. If Lydee’s mother has saved up $250 f
• A committee with members from both the House of Representatives and the Senate is called a __________. A. double committee B. joint committee C. cooperative committee D. conjoined committee
• Read the excerpt below and answer the question. But this is the mountain standing in the way of any true Negro art in America—this urge within the race toward whiteness, the desire to pour racial in
• In the literary analysis of "The Negro Artist and the Racial Mountain," what can be considered the main conflict in the essay? Proper recognition of Negro artists will never exist in society. Imitatin
• Submit three to four (3-4) page paper in which the student addresses the following three (3) items using headers to separate each response:...
• Monique buys a $4,700 air conditioning system using an installment plan that requires 15% down. How much is the down payment?
• M7A2 Problem Write-up:
• What is the inverse of f(x)=-5x-2 Show steps
• If Andrew is staying in a primary sector economy, then which of these could be an important occupation in Andrew’s country?
• Determine what discount rate (WACC) Soco should use to evaluate the warehousing facility project.
• A client complains of difficulty breathing. the nurse auscultates wheezing in the anterior bilateral upper lobes. what could be the possible reason for this sound?
• Tim adds salt as he starts to heat a pot of water to cook pasta. When the water is boiling, he notices the salt has dissolved explain y
• choose molecular shape linear bent trigonal bipyramidal seesaw square plane tetrahedron icosahedral square pyramidal trigonal pyramid T-shape
• sq root 4x^4y3/16xy^5 simplify assuming all variables are positive
• How to do it' is a company which provides information and products for the DIY sector.
• Write a two to three (2-3) page report in which you: Calculate the mean, median, and standard deviation for ounces in the bottles.
• Imagine that you are the marketing manager for a U. manufacturer of disposable diapers. Your firm is considering entering the Brazilian market.
• Do some research on Verizon and Sprint. Get an idea of their working capital management policies from publicly available information?
• Brainliest if answered in next 10min correct answers please Describe what happens to the electrons in a neon that is heated to incandescence and then when the heat energy is removed. please help if a
• Sample Response: The sonnet shows that Romeo and Juliet are both familiar with love poetry. They are both smart, and they recognize what the other is doing, so that makes them well matched. By using a
• The Difference Between Data Governance and Information Governance
• Return on Capital for 4 Sectors The case has financial data of some companies drawn from four different industry sectors - Banking, Computers,...
• The purchasing manager has provided the following information for your use:
• how do i calculate this ?
• If a person with O blood type produces offspring with a person with B blood type, then what percentage of their offspring will be type O in the best case scenario? A) 40% B) 50% C) 90% D) 100%
• CRJ100: Corrections Case Study The history of correctional institutions is well-documented.
• Assignment: Write a 3-4 page APA formatted paper comparing your organization’s disaster recovery and business continuity plans with the best practices outlined in our course text. Content should inc
• Describe How you would design a cell for Lean layout?
• The raise issues that are direct or indirect effects of the use of information technology: online addictions How serious an impact does your chosen
• 1. The Napoleonic Code waa a reform of France’s a. political system b. educational system c. legal system d. economic system 2. Which country was able to remain outside Napoleon’s European Empire?
• Assignment: Write a 3-4 page APA formatted paper comparing your organization’s disaster recovery and business continuity plans with the best practices outlined in our course text. Content should inc
• The issues that are direct or indirect effects of the use of information technology:
• the targeted destruction of a portion of the anterior cingulate cortex is used to treat severe .
• metal rod is 40.126 long at 20.0 and 40.149 long at 45.4 Calculate the average coefficient of linear expansion of the rod's material for this
• In 1977 the Richardson family tired of the congestion and crime associated with urban life moved from their townhouse located in the middle of the city to the suburbs which of the following terms desc
• subtract the rational expression 3x/x+1 - x-4/x^2+2x+1
• What is Lowes FY 2011 start up cost per store? What accounts do you use?
• · Describe any concerns you have or challenges you might anticipate as an online learner.Identify one strategy and one resource/tool from the Learning Resources that may contribute to a successf
• Suppose the price elasticity of demand for farm products is elastic.
• a X year note at N% with a loan of any amount? Example if I have a loan of 800,000 I secured a 5 year note of 9% what is the accrued interest amount?...
• Amniocentesis is a process in which amniotic fluid is taken from the mother's womb to identify any genetic abnormalities in the fetus. How would the discovery of the human genome contribute to this pr
• What is compound interest? Compare compound interest to discounting? 2. Why does money have time value? 3. How is present value affected by a change
• Read the passage from “I Know Why the Caged Bird Sings.” Occasionally, though, Mrs. Flowers would drift off the road and down to the Store and Momma would say to me, "Sister, you go on and play."
• Carson Inc.'s manager believes that economic conditions during the next year will be strong, normal, or weak, and she thinks that the firm's returns...
• Suppose you are a health club owner and you are approached by a PRIDE salesperson who says, "The PRIDE database is located in an XYZ cloud facility,"...
• Compute a numerical value for the area under the standard normal distribution, between 0 and 1. Compute a numerical value for the area under the...
• A prospective MBA student earns $45,000 per year in her current job and expects that amount to increase by 12% per year.
• Compute a numerical value for the area under the standard normal distribution, for z greater than or equal to 1.
• Compute a numerical value for the area under the standard normal distribution, for z less than or equal to -1.
• Find the area under the normal distribution curve between z = 0 and z = 2.
• Jim Jones randomly guesses the answers to a five-question true/false section on the securities analyst exam. If there is a 0.
• Expando, Inc., is considering the possibility of building an additional factory that would produce a new addition to their product line. The company...
• Suppose the production function for DVDs is given by Q = KL^2 L^3 , where Q is the number of disks produced per day, K is quantity of capital, and L...
• The panther paused to sniff the humid night air. It heard noises up ahead, but it did not recognize the sounds. The strange noises continued, and the panther became frightened. The panther crept into
• Short answer (ONE super awesome paragraph): Why are coffee pickers paid low wages? What do you think the chances are that coffee pickers will ever
• Short answer (ONE super awesome paragraph): What were the reasons for increased consumption of coffee (and tea and sugar) during the Industrial
• I am having trouble completing it.
• Humans have 10 times as many bacterial cells (prokaryotes) living on and in us than we have eukaryotic cells that make up our bodies.
• Please answer the questions completely and provide explanations to the questions. Question 1 In the equation of exchange, suppose that M = 10,000, P...
• A literary analysis should contain a A. thoughtful interpretation of a work. B. brief and simple response to a work. C. response to a work based on popular opinion.
• What specific tools/instruments can a central bank utilize to achieve its objective of curbing inflation?
• Geologic time begins with a very long span called Precambrian Time. Precambrian Time ended about 544 million years ago. Since then, the basic units of geologic time are, in order from longest to short
• please help create a timeline describing the development milestones that occurr in the stages of fertilization, embryonic development, fetal
• The genome is the complete set of genetic material in an organism. Give 3 other quot;___omequot; terms and what each of them comprises.
• All that stirring of old instincts which at stated periods drives men out from the sounding cities to forest and plain to kill things by chemically propelled leaden pellets, the blood lust, the joy to
• Write a stored function called zip_exist that takes in a zipcode.zip%Type parameter and returns a Boolean. The function will return TRUE if the...
• Jazz World Inc. is considering a project that has the following cash flow and WACC data. What is the project's NPV?
• The main concern of the national labor relation board is with?
• Please explain answer. Which of the following statements concerning the MM extension with growth is NOT CORRECT?
• Theodor is researching computer programming. He thinks that this career has a great employment outlook, so he’d like to learn if it’s a career in which he would excel. What two skills are importan
• In a system, we have 5 instances of device A, 6 instances of device B, 5 instances of device C, and 8 instances of device D. Consider the following...
• Hi Hiram, Reading your post, I found it interesting on how you describe the strategies that health care administrator would take to reduce surgical...
• Focus of the Final Paper Your analysis should cover the following points: Discuss the culture and socio-political background of the country you...
• The concentration, or abundance, of ethyl alcohol in a typical molecular cloud is about 1 molecule per 10 8 cubic meters.
• Based on the information in the table, which statement would most likely be a belief shared by both Martin Luther and John Calvin?
• Fetch And Add (FAA), atomically increments a variable and returns the old value of the variable. FAA (var, increment) adds increment to the variable...
• 21. A very short eukaryotic mRNA has the sequence... 5' ACGCCGAUCAUGGGCAUGCGAGUAUAAAAACUGG 3 ' How many amino acids are encoded by this message?
• It just looked very long, not so much work!(There are may some mistake in given code, If there is one, just skip that, and mind me that). We have...
• Shandon makes $183 in 21 hours of work. How much would Shandon make in 10 hours of work? (Round to the nearest cent.)
• 3-phosphoglycerate (3-PGA) and dihydroxyacetone phosphate (DHAP) 2. 2 molecules of 3-phosphoglycerate (3-PGA) 3. glyceraldehyde-3-phosphate (GAP)...
• Operating data for Poll Corporation are presented below.
• explain how and where the goals for effectiveness of operations would be shown in the control goal columns of a control matrix prepared for the OE/S...
• have ragged red fibers accumulating Elderly patients accumulate mtDNA damage So how do these `symptomsquot; of aging happen? What are free radicals?...
• Calculate the volume of oxygen you would need, at 1.00 atm and 298 K, to completely oxidize 54 g of glucose.
• 61. If orangutans are the outgroup of humans, chimps and gorillas, what type of chromosomal change resulted in the derived karyotype?
• If you have a 10 foot ladder and you put it against a wall at the ideal angle how high on the wall will the ladder touch assume a 90 degree angle between the wall and the floor please use complete sen
• 7.1 How Does Glucose Oxidation Release Chemical Energy?
• - A contract between Sportz Equip Corporation and Time-To-Play Stores, Inc., includes a provision excluding liability as a result of fraud.
• Selected comparative statement data for Tyrone Company are presented below. All balance sheet data are as of December 31.
• Pollutants can harm ecosystem function and may also harm human health. You will write a research paper about pollutants, their impacts, and...
• Knightstown has a property tax base with an appraised value consisting of 142,000,000 of taxable real property and 78,000,000 of taxable personal...
• Roger Baker has accumulated $600, 000 in his RRSP and is going to purchase a 25-year annuity from which he will receive month-end payments. The money...
• 1. Glucose, a six-carbon chain, results from the output of the Calvin cycle. Did your exercise generate a glucose molecule?
• When PCl 5 solidifies, it ionizes according to the following equation: 2PCl 5 gt;PCl 4 + + PCl 6 . Choose the correct molecular geometry of the...
• What was the Treaty of Versailles? What did this treaty accomplish? How did the treaty help lead to World War II in Europe?
• You are appointed to the hospital's information technology committee as the representative for your unit, and you are required to address the...
• What was the Cold War? Who was involved? Was it really a war? How did it end?
• 1) What was the Iron Curtain? 2) Who was the American President during the Cuban Missile Crisis? 3) What is NATO?
• When the housing bubble collapsed in 2007, ____ rose significantly, and the Fed ____ interest rates.
• Which of these expressions can you NOT use when you meet someone for the first time?
• Project X costs $1,000, and its cash flows are the same in years 1 through 10. Its IRR is 12%, and its WACC is 10%. What is the project's MIRR?
• Irwin, Inc., constructed a machine at total cost $35 million. Construction is completed at the end of 2005 and the machine was placed in service at...
• How many times larger is 4.562 x 10^45 than 2.82 x 10^24? ( please round the coefficient to the nearest ten thousandths place)
• https://www.theguardian.com/world/2017/oct/29/mexico-corruption-pri-santiago-nieto Please develop a summary and commentary on this news article.
• NURS6053 inter prof. Describe a department or unit within a health care organization using systems theory terminology.
• This goes to tropica junior moderator my question was that you guys were lying to me and i wanted to know why!!!!!!!!!!!!! r u guys stupid!
• Please answer the following questions Case 3:
• Should Texas extend the legislature's ability to meet and solve problems at a state level (potentially forcing higher taxes), or should Texas stay
• Spring break had arrived and Carol's family went camping along the river seen here. During their stay, the family dug for fossils. Carol's father found pieces of elk skull and the bones of some other
• Present Aristotle's Doctrine of Mean . Students must develop at minimum two virtues to present the point and adequately develop the necessary...
• Indicate whether the following species contain an ionic bond or only have covalent bonds.
• Nutrition education programs, which teach clients how to lose weight, reduce cholesterol intake, or reduce fat intake through better eating patterns,...
• Arrange the following elements in order of increasing electronegativity.
• 4.Explain the events that occur when you smell apple pie. Include the following words: olfactory epithelium, smell receptors, olfactory nerve, and olfactory bulb.
• can someone please revise my paper I need so use different words and put it in a a right order
• GAAP vs. IFRS: Explain the steps that would be needed for your selected portfolio company to transition from GAAP to IFRS.
• Purvis Enterprises acquired a patent from Whitt Metalworks in exchange for 5,000 shares of Purvis' $10 par value common stock and $86,000 cash.
• Healthcare stakeholders disagree about the impact of legal risks, medical malpractice claims, tort reform, and defensive medicine on the cost of care...
• g a systems analysis and design methodology when building a new system instead of building a system in any which way that seems to be fast and simple?...
• Your company has an opening for a junior database administrator.
• Why is it important to understand linear equations in business?
• 1Differentiation is described as the process of a cell becoming more specialized. What is the difference between dedifferentiation and
• 1. Congratulations! You have just been hired as Director of Human Resources. What do you want to do first? What would you do on an ongoing basis? What will you never do?2. Select one (1) ad
• For this discussion, identify the costs of issuing equity as well as any advantages and disadvantages of engaging in this process.
• Would Machiavelli ever find the mass killing of civilians unacceptable? Does he believe revolution is sometimes necessary?
• A researcher wishes to estimate the number of households with two cars.
• at 27.0 degree Celsius a gas has a volume of 6. what will the volume be at 150.0 degree Celsius. what's the equation for it.
• The internal rate of return rule can result in the wrong decision if:the projects being compared are independent.the projects being compared have...
• LIability Define and describe the following business entities: Corporation, Limited Liability Company, and Limited Liability Partnership. Describe...
• Hi, what combination of exploration and commitment scores are seen for foreclosure?
• Describe the means by which a corporation might raise capital. In your response define and describe the different types of financial securities which...
• Can someone help me understand what contrast and novelty ads are?
• The following data show samples of three chain stores in three different locations in one town and the amount of dollars spent per customer per visit....
• What are several business decisions that you will have to make as a manager that have both ethical and IT dimensions?
• embryonic period A. extends from the seventh month until birth. fetus B. extends from the start of the fourth month to the end of the sixth month....
• According to Kierkegaard, our most passionate ethical commitments are to
• A 35kg girl is bouncing on a trampoline. During a certain interval after she leaves the surface of the trampoline, her kinetic energy decreases to...
• 01.04 How Theme Develops You will read a story and analyze how theme develops in the story. View the grading rubric as you complete your assignment. This is your guide to a super submission. Select th
• Assignment 5: Federal Contracting Activities and Contract Types Due Week 10 and worth 240 points Note :
• Coke and Pepsi each choose one of two prices: "Low" (P = $2) or "High" (P = $3). There are 50 buyers who will pick the lowest price option.
• Waterfront Manufacturing Company is purchasing a production facility at a cost of $21,000,000. The firm expects the project to generate annual free...
• Select the correct adjective form for the following sentence. Barkley is the _____ of the two pups. lively livelier liveliest
• Discuss four possible effects that may occur when a cell receives instructions from two different hormones
• Turner syndrome occurs in females who instead of having two X chromosomes have either only one X chromosome or a fragmented X chromosome. Klinefelter syndrome occurs in males who have multiple X chrom
• ody weight an important performance and health protection? What are some potential consequences of an athlete dropping below this minimum body weight?...
• Tracy is finding the equation of a median-median line. She found that the equation of the line through the first and third summary points is y = 0.4x + 38. Then she found that the equation of the line
• 1.You are Purchasing and Sales Vice President for a large Texas corporation. The CEO tells you he needs an outline of basic contract law to use for new employees in your division. He will take it to
• I need help on those essay questions: 1) What led to the development of the Monroe Doctrine, and how did President Monroe transmit his ideas to the
• I was wondering if there was an excel formula that would return a value that it is greater than the previous value by 1. The previous value can...
• The cash flows used in capital budgeting calculations are:taken from the past history and backward looking.based on forecasts of future cash...
• A sealed flask contains 0.50 g of water at 28 ^\circ {\rm{C}}. The vapor pressure of water at this temperature is 28.36 {\rm mmHg}.
• Hilltop Market is offering 60,000 shares of stock to the public in a general cash offer. The offer price is $30 a share and the underwriter's spread...
• Consider this statement: Once you have developed documentation standards which meet organisational requirements, there is no need to spend time...
• tax legislation is at the forefront of current news: the anticipated changes to the tax code are expected to be the largest fundamental changes in a...
• Find the critical points. Use the second derivative test to classify each critical point. Find the relative extrema of the function.
• Briefly explain the term "carried interest" and discuss the tax controversy surrounding it.
• If a firm has bonds outstanding and the firm would like to calculate the current cost of debt for the bonds, then the firm would:
• How would you change the distance between two charged particles to increase the electric force between them by a factor of 16? a) reduce the distance by a factor of 4. b) increase the distance by a fa
• . If a liquid only half as dense as mercury were used in a barometer, how high would its level be on a day of normal atmospheric pressure
• Two-month-old Trey is crying loudly. His cry starts with a piercing shrill sound.
• Nonparametric statistical measures: (Points: 5) compare population means or proportions to determine the relationship between variables.
• There were 5 questions submitted as an attachment Chapter 11 Homework submitted on Saturday, July 24th, with a deadline of today 5PM. I have received...
• Ead the poem below and answer the question that follows. “She Walks in Beauty” by Lord Byron She walks in beauty, like the night Of cloudless climes and starry skies; And all that’s best of dark
• Every time someone sells a stock believing that the price will soon decrease, someone else buys the security:
• The individual conveying real estate is called the ________ and the individual acquiring title is called the ________.
• The __________ oversees, regulates, administers and enforces the real estate law.
• How did environmental differences affect social, political, and economic institutions in the Delhi Sultanate, and Mesoamerica?
• The term ___________ refers to the fact that these cash flows reflect the amount by which the firm's total after-tax free cash flows will change if...
• Thank you! Terry Malloy is trying to decide whether his shipping company should invest in a new boat.
• A monatomic ideal gas with initial pressure 1.2*10 5 Pa and initial volume of 0.5 m 3 expends isothermally to a volume of 1.8 m 3 .
• Comet Pasta Company stock currently sells for $137.5 per share.
• As we read and discuss the definition of politics, let's also consider the consequences of political decisions on our everyday lives.
• Define the current business environment for Google. Include information about political, legal, economic technological and societal factors that may...
• What is ppm? A. Concentration of a solute in mol/mol solution B. Concentration of a solute in grams/106 grams solution C. Concentration of a solute in mol/kg solvent D. Concentration of a solute in mo
• Do athletes training at high altitudes have more or less oxygen molecules per ml of blood then athletes training at low altitudes?
• The Sisyphean Company has a bond outstanding with a face value of $5000 that reaches maturity in 5 years. The bond certificate indicates that the...
• Question: Thread: Week 1 Discussion - HUM112027VA016-1172-001 Instructions: Please respond to one of the following two questions, using the sources...
• only 1 topic and 3paragraphs quot;Encryption in Organizationsquot; Select one of the following and discuss in no less than three paragraphs, and
• Explain what each of the 3 classification of ratios that we can utilize to analyze the financial statements?
• Should autonomous vehicles be endowed with the capacity to choose targets in crash-optimization scenarios? Why, or why not?
• which of the following is not an argument in favor of having a single supplier?
• Which one of the following correctly matches a country with its currency?
• Was the main purpose of the Ku Klux Klan to destroy the Republican Party?
• A security interest in a piece of equipment owned by a business would most often be perfected by
• When a brand becomes commonplace and identified with a category of goods rather than the unique product of a specific manufacturer, the brand may
• (NEED HELP ASAP) Which action best demonstrates the transformation of mechanical energy to heat energy? A) digesting a meal B) burning a candle C) rubbing hands vigorously D) melting a piece of ice in
• 18. If the solubility of a gas is 7.5 g/L at 404 kPa pressure, what is the solubility of the gas when the pressure is 202 kPa?
• What was the Anaconda plan in regards to the Civil War?
• spool createTable.
• Last year Altman Corp. had $205,000 of assets, $303,500 of sales, 418,250 of net income, and a debt-to-total assets ratio of 41%.
• Industrial deep-sea divers must breathe a mixture of helium and oxygen to prevent a disorienting condition known as nitrogen narcosis.
• After 6 years from graduation, you became a general manager, and now you have to invest your limited fund into the most profitable internal projects...
• If a company's bond rating is downgraded by S amp; P, what would happen to the price of the existing bonds in the market?
• Explain how an organization's mission, vision, values, and culture influence its relationships with its employees.
• The United States in International Economics: What are the ways that government policy impacts poverty?
• When discounting dividends for the purpose of common stock valuation you should use: the weighted average cost of capital. the after tax weighted...
• make a data set consisting of two groups, with 35 random observations per group. Repeat this 19 more times, i., there should be 20 sets, each...
• SHOW YOUR WORK Sara is working on a Geometry problem in her Algebra class. The problem requires Sara to use the two quadrilaterals below to answer a list of questions. Part A: For what one value of x
• Your Mobile Ordering Project team assigned you to write the Mobile Ordering Project POS Requirements Document.Include the following elements in your documentation:Identification of the core components
• 1) A groundwater sample is in equilibrium with CaCO3 and CO2(g). The Ca2+ ion concentration is 124 ppm. Determine the concentration of HCO3- (in...
• Bellamee Company has bonds outstanding with five years to maturity and a face value of $5,000. The bonds are currently priced at their face value.
• In his Virginia Statute for Religious Freedom, Jefferson argues that the impulse for belief and religion comes from _____. the official Anglican Church the free, reasoning mind fallible, uninspired mi
• 2009 Pearson Education, Inc. Our goals for learning: How does a stars mass determine its life story? How are the lives of stars with close companions...
• The average period of the polar wandering is in excess of 400 days. The annual variations in earth rotation are due to the heating and cooling of the...
• So far this semester, you have studied several different types of statistical tests that can be used in different situations (e. independent-samples...
• why the stock price goes up and down when a company announces a certain strategic plan?
• Gangland Water Guns Company is expected to pay a dividend of $2.10 one year from today.
• Martinez owns an asset that cost $87,000 with accumulated depreciation of $40,000
• Periodic Inventory System and Inventory Costing Methods P 1. El Faro Company merchandises a single product called Smart.
• Strategic management is the process of involving nonmanagerial employees in the formulation and implementation of strategies and strategic goals
• describe feudalism and give the two main social classes of a feudal society.
• If exports rise and imports fall, then what will happen?
• Comet Pasta Company stock currenly sells for $137.50 per share.
• What steps do you believe agencies should take to ensure that probation officers and parole officers are equipped to conduct screening instruments
• The Harrisburg city manager and the chief of police agreed on the size of the police force necessary for normal daily operations.
• How does the event described in this headline demonstrate the American policy of containment in the early years of the Cold War?
• Economic theory supports the view that increasing the minimum wage will Increase the employment of teenagers Decrease the employment of teenagers
• find the volume of 19.5 g of CCl4 at 972 torr and 29.
• 1. Which of the following statements applies to a purely competitive producer?
• An auto mechanic spills 78. mL of 2.5 M H2SO4 solution from a rebuilt auto battery. How many milliliters of 1.3 M NaHCO3 must be poured on the spill
• What is a bond's market price when the required rate of return on the bond (=market interest rate) is less than the coupon rate?
• Droz's Hiking Gear Company has found that its common equity shares have a beta equal to 1.50 while the risk-free return is 12 percent and the market...
• After you studied finance, you realized that there would be significant difference of wealth accumulation even if people receive the same salary.
• Show work and how to solve by completing the square for:
• 1.You are Purchasing and Sales Vice President for a large Texas corporation. The CEO tells you he needs an outline of basic contract law to use for new employees in your division. He will take it to
• Why do you think that Jackie Robinson's character and actions off the field mattered so much more than the character and actions of white players?
• At that time the unamortized balance of the bond discount was $1556. Use the straight-line method to amortize any discount/premium.
• A better explanation of what the Monroe doctrine was.
• A. Indefinite life intangibles other than goodwill. The recoverability test is used to determine any impairment loss on which of the following types
• Which of the following statements about the payback method is true?
• The Baldwin Company has just purchased $40,900,000 of plant and equipment that has an estimated useful life of 15 years. The expected salvage value...
• Miles Cyprus Company purchased a truck that currently has a book value of $1,000.
• Which concept is central both to the Declaration of Independence and to Social Contract Theory? a) the authority of the government to create a militia to defend its citizens b) the authority of the g
• 1.You are Purchasing and Sales Vice President for a large Texas corporation. The CEO tells you he needs an outline of basic contract law to use for new employees in your division. He will take it to
• Which of the following research and development related costs should be capitalized and depreciated over current and future periods?
• Value contradictions occur when commonly held values conflict.
• Lynne Corporation acquired a patent on May 1, 2010. Lynne paid cash of $30,000 to the seller. Legal fees of $1,000 were paid related to the...
• Create a timeline tracking the major themes/paradigm shifts in American History from the Columbus's voyages through the Mexican-American War...
• QUESTION: Prepare the T-accounts for Month 5 for David's blood pressure monitoring service (see info in this week's Prezi) utilizing the information...
• Can you give me an example of a authoritative reference?
• Determine whether this statement is true of false a figure that has opposite sides with equal length and equal slopes and diagonals with slopes that are negative reciprocals must be a square
• A motorcycle accelerates uniformly from rest to a speed of 7.10 m/s over a distance of 35. Determine the acceleration of the motorcycle .
• Adaptation of an existing capability to a particular requirement or customerquot;s need. 12 - 16 Test Bank for Intermediate Accounting, Thirteenth...
• legal fees and amortized over 5 years or less. expenses of the period. patents and amortized over the remaining useful life of the patent....
• Unless otherwise indicated, assume that the U. Model Income Tax Convention of November 15, 2006 (the "Model Treaty"). Bill, a citizen of country F,...
• Given r ( x ) = 6 xx + 7 , find the following .(a) r (0) =0 (b) r (1) = (c) r (3) = (d) r( 1/2) = (e) r (0.
• JoyPetro Company refines a variety of petrochemical products. The following data are from the firm's Amarillo plant.
• If country A is better than country B at producing all goods, will country A still be made better off by specializing and trading?
• Discuss the quot;nature vs. nurturequot; controversy. Define each term and the types of research that should provide data to support each argument....
• The marketing department is estimating product A's demand to be 60 units for week 4 and 50 units for week 6. There is a scheduled receipt of 75 units...
• Imagine a day in your life without any computerization. How would it be different?
• 1.You are Purchasing and Sales Vice President for a large Texas corporation. The CEO tells you he needs an outline of basic contract law to use for new employees in your division. He will take it to
• quot;Application and Recommendationsquot; Please respond to the following: Determine two (2) ways you can apply sociology principles in your...
• discuss elements of cost,gross profit percentage and selling prices for products and services
• Women's governor refers to in the policy of segregation in public universities he invoked which common argument for separation of powers under federal-ism
• Texting is the easiest and fastest way to communicate in this day and age. We use this technology to talk to almost everyone in our lives, from...
• The service industry has become the cornerstone of the US economy. Customer service has become the defining element of many businesses.
• The defendant is on trial for murder. The prosecution alleged that she killed the victim because the victim stole the defendant's husband.
• Victor and Maria's Retirement Plans Victor, now age 61, and Maria, age 59, plan to retire at the end of the year.
• 1. Why do some researchers use the analogy of culture as a tree or cultureas an iceberg?
• Explain how the quot;middle-of-the-roadquot; strategies bridge the disparity between ethical relativism and ethical imperialism.
• Jason, a visually impaired employee of Melony Inc., believes that his workplace has given him independence and self-confidence, thereby increasing...
• Which of the following statements is true about strategic alliances?
• Water is flowing into a conical drinking cup with an altitude of 5 inches and a radius of 3 inches, in (a) Write the radius r of the surface of the...
• How does hypothesis testing contribute to the scientific knowledge base?
• 16. How many equivalent resonance forms can be drawn for SO2 without expanding the octet on the sulfur atom?
• Harris, Chapter 1, problem 32: What is the density of 53.4% aqueous NaOH if 16.7 mL of the solution diluted to 2.00L gives 0.169M NaOH?
• Case p.161 Samp;S Air's Mortgage 1. What are the monthly payments for a 30 year traditional mortgage? What are the payments for a 20 year
• Explain how the author of the poem 'St. George' (by Nancy Senior) used satire as a means of conveying a message about humanity during the time in...
• Sunflowers have specialized cells that enable the sunflower to track the Sun. Which of the following allows the sunflower to move to face the Sun? A. Gravity B. Electricity C. Fraction D. Turgor
• How does Regulating manufacturing processes affect green computing?
• Susan, 20, wants to have $1,000,000 at age 50 (after 30 years).
• In Pavlov's experiments with dogs, which object represented the conditioned stimulus?
• A car accelerates uniformly from 18.5 m/s to 46.1 m/s in 2.47 seconds. Find the acceleration of the car and the distance traveled.
• Personal Derek Parfit [1] We can, I think, describe cases in which, though we know the answer to every other question, we have no idea how to answer...
• References not needed, double spaced not needed but answers need to be original.
• What process will completely stop if you used an herbicide to inhibit PEP-Carboxylase in corn plants?
• Apply the variation function x^2(a-x)^2 for x between 0 and a, to the particle in a box and estimate the ground state energy, E_gs.
• A proton in a linear accelerator has a de Broglie wavelength of 128 pm what is the speed of the proton?
• Identify the statement below as either descriptive or inferential statistics. A certain website had an average of 776 visitors per day last week.
• which of the following is not a conditional right?
• An exam has two probability problems, 1 and 2. If 37% of the students solved problem 1 and 12% of the students solved both problems 1 and 2, what percent of the students who solved problem 1 also solv
• Here are some shopping times (in minutes) for a sample of 5 shoppers at a particular shoe store: 22,33,43,21,31. Find the standard deviation of this...
• Why do the protesters pictured in Document 2 compare the 1968 Miss America pageant to a livestock auction?
• Suppose there is a set of growers G = {a, b, c, d}, a set of retailers R = {e, f, g} and a set of customers C = {m, n, p, q, r}.
• Which description best explains the significance of this excerpt to the current government of Massachusetts?
• The way communication has changed the last 50 years 
• Find f 1 ( x ). f ( x ) = x 2 + 2 x , x 1 f 1 ( x ) = State any restrictions on the domain of f 1 ( x ).
• job evaluation :
• A hotel pays the phone company $200 per month plus $.30 for each call made. During January 10, 000 calls were made. In February 8,000 calls were...
• Rest amp; Sleep Inc. is a mattress manufacturing firm.
• In more than sevnty five words discuss the reasons for fund accounting. Be sure to explain the measurement focus and basis of accounting of the...
• Hoping to have the topic be the history of LGBT inequality and global LGBT movements. So stuck anything helps even helping me find sources...
• The way communication has changed the last 50 years
• The way communication has changed the last 50 years
• You are interested in buying a brand new Lexus IS-F, which costs $70,000 with full of cool options. A bank will lend you 100% of the purchase price...
• A funnel is made up of a partial cone and a cylinder as shown in the figure. the maximum amount of liquid that can be in the funnel at any given time is 16.59375 pie cubic centimeters. given this info
• Pleasanton Industries has identified list of financial and nonfinancial performance indicators:
• A chemistry handbook lists the solubility of sodium Iodide as 184 grams per 100mL of water at 25 degrees celsius. How many moles of NaI can be
• Write Project -Proposal relating to this topic (The impact of obesity in Saudi Arabia) note:
• Octane has a density of 0.692 g/mL at 20 C. How many grams of are required to burn 1.50 gal of C8H18?
• A hydrogen molecule consists of two hydrogen atoms whose total mass is 5.
• If you do not already have one, make folder on your computer or external drive called ite 170 2.
• Enter the word that best completes the sentence. Word Bank overflow influx engross consume devour torrent When you cook soup in that small pot, it could boil over, so watch out for .
• You just decided to begin saving for retirement. You will make deposits of $1,000 per month into a retirement account that earns 8.00% p.a. The first deposit is made today and the last deposit will be
• Project 9, COP 3514, summer 09 - due Friday June 22 midnight 1. (60 points) Write a program to extract Web addresses starting with www. and ending...
• Which factor of production is represented by each of the following?
• Compare and analyze the ways the Roman and Han Empires promoted peace and stability along their borders.
• The table below contains hypothetical international balance of payments data for Canada. All figures are in billions.
• es market to hedge against rising interest rates? What is the difference between using derivatives to hedge against risks and using them to speculate?...
• The following are distances (in miles) traveled to the workplace by 6 employees of a certain brokerage firm. 20,9,18,13,16,20. Find the standard...
• strategy? Within competitive strategy what is the relevance of a value change framework? What are the implications for customers and the competition?...
• Use the following passage to answer the question. (1) Water is something most of us take for granted. (2) If we need a cold drink or want to take a shower, water is there. (3) If we want to water our
• Suppose that the American Congress (AC) passes a bill that prohibits the short selling of stocks, which makes impossible for investors to have profit...
• Find the area of the region in the positive x axis bounded by the curbed y=x, y=8x, and y=1/x^2 a) Graph the region described b) Find the points of
• Your grandfather clock's pendulum has a length of 0.9930 m. If the clock runs slow and loses 21 s per day, how should you adjust the length of the
• Excel Tutorial 7 Case Problem 2 Question 4. Page 414.
• What is the radius of the circle if the arc is 10 feet long and the angle is 2 pi/3 convert to decimal form
• Question 1: Hydrocarbons (12 points) A. Draw the structural model for butane (using C and H). (6 points) B. Draw the stick (or skeletal) model for...
• Which provisions in the Constitution give the federal government power to create, regulate, and mandate healthcare policies and according to whom?
• Which job would you NOT be able to get unless you were part of the CCP? A) government B) economic C) military D) business executive
• Social networking is one of the largest and most frequent IT Security risks at your company.
• print(quot;Welcome to the get to know you programquot;) name = input(quot;What is your name? quot;) age = int(input(quot;What is your age?
• The Super Ball lottery was won by Joan; her winnings were $500,000.00 to be paid in quarterly payments of $12,500.00 each over the next 10 years. How much must Super Ball deposit in an account paying
• Five years ago you bought 100 shares for $25 each and sold them today for $35 each. Today this investment paid a $1 dividend per share. a) What was
• An employee wants to invest $60,000 in pension plan. One investment offers 4% compounded semiannually. Another offers 3.25% compound continuously.
•  Write a 1,050- to 1,400-word paper in which you examine language as it relates to cognition. Address the following:Define language and lexicon.Evaluate the key features of language.Describe the four
• By the graduation, you saved $35,000. Instead of buying a new BMW, you cleverly decided to buy a 10 year old Nissan Versa and deposit the remaining...
• Can you please check my answer ?
• Find the absolute maximum value (if any) for f on the interval [-1,3], given that f(x)=2x-5x(4/5)+5 a) 5 b) no absolute max value c) -7.6335 d) 32 e)...
• What does it mean to say managers should organize for both exploration and exploitation?
• Patricia owns a small real estate business. A week ago, she showed an apartment to a couple who just moved into the city. The couple stated that they could afford the apartment. Patricia showed them a
• Discusse the ethical implications of monitoring user compliance with secure transmission activities as components of a framework for a secure
• A correlation coefficient is an index number constrained to fall between the range of: 0 and 1. 0 and 100.00 and +1.00 and 0. -100 and 0.
• WHAT CHANGE DID THE SUPREME COURT CASE DRED SCOTT V. SANDFORD MAKE TO AMERICAN LIFE?
• The independence movements across the world following WWII is known as what? Question 7 options: a) Anti-Imperialism b) Decolonization c) Industrialization d) Globalization Save Question 8 (1 poin
• Why was the Bill of Rights included in the Constitution? A) to protect the rights and freedoms of individual citizens B) to put governing power in the hands of the central government C) to put governi
• adasdasdasdasdasdasdasaasd adasdasdasdasdasdasdasaasd adasdasdasdasdasdasdasaasd
• Hey can you please answer this electronics questions ?
• This assignment consists of reading the following scenario and composing a paper regarding what managers must do to lead change and achieve their
• A balloon is inflated to a volume of 8.0 L on a day when the atmospheric pressure is 765 mmHg. The next day, as a storm front arrives, the...
• Question 3 (15 points) Assume all the coupon bonds have just paid out their respective semi-annual interest payments today.
• Please show work! Calculate the number of moles and number of grams of H2C2O4*2H2O required to completely neutralize 25mL of 0.12 M NaOH. How many...
• Which table shows a proportional relationship between x and y? x 1 3 4 5 y 50 150 200 250 x 1 2 3 6 y 1.5 3 6 9 x 3 5 7 8 y 1.5 2.5 3 4.5 x 2 4 5 6 y 6 12 18 21
• //faculty.edu/~cartonj/_fpclass/3223H3_f17.pdf I'm having trouble with 5 problems, problem 6, and 8-11.
• 1.What is the mass of 6.5 moles of sulfur? 2. How many grams of silver chloride can be produced from the double displacement reaction of 17.0 g
• I am not very good with computers and would like if someone help me with these questions. Thank you. Microsoft Office EXCEL What is AutoCorrect? What...
• Research the Dell website.
• I am not very good with computers and would like if someone help me with these questions. Thank you. Microsoft Office POWERPOINT What is a paragraph?...
• A store sold $585,000 in August of 2016. In August of 2015 sales were $529,000. What was the percentage increase?
• Cost Plus Inc.'s portfolio of marketable securities was as follows (all securities were purchased in the current year):
• which of the following union best represents the exclusive unionism model?
• John is building a rectangular puppy kennel up against his house using 31 feet of fencing. The side against the house does not need a fence and the side parallel to his house needs to be 15 feet long.
• The monthly salaries (in thousands of dollars) of a sample of 6 sales representatives are as follows: 6,10,7,9,11,11. Find the standard deviation of...
• did stein suffer a loss as a result of Gortino's action, not let stein know that there where termites issue when he sold her the property.
• In an attempt to reduce our dependence on non-renewable resources, and cut down on the harm to the environment, we could burn ______ to produce electricity. (2 points)
• 1. Which of the following is most likely to be an implicit cost for Company X?
• The logistics performance cycle is which of the following
• Can a controversial piece of art ever make a social contribution? Does it depend on the nature of the controversy?
• ONLY PEOPLE WHO HAS READ THE DIARY OF A YOUNG GIRL SHALL ANSWER! I WILL GIVE BRAINLIEST!!!!!!!!!!! Write a short (1-3 paragraph) book review about The Diary of a Young Girl. The review should give a s
• The dividend payout ratio is the dividend divided by the stock price.
• The potential of a tax loss carry forward has no effect when considering the acquisition of a company.
• A 57-g ball consists of a plastic spherical shell and a water-filled core. the shell has an outside diameter equal to 41.4 mm and an inside diameter...
• Question: The poverty line in this society is at Y=C=66 . A program is proposed whereby a subsidy S=66Y is given to anyone whose income Y is below 66...
• the sides of a cube are labeled 4,5,6,7,8,9, what is the probability of getting a 6 (answer in a fraction in simplest form please)
• What is Chinas Currency/FX movement vs US last 5 years, predictions for next 6 to 12 months?
• quot;How Abortion hurts Woman: The Hard Proof.quot; 2005 https://www.
• Black-Scholes model shares common intuitions with risk-neutral option pricing model (also known as the binomial option pricing model).
• European options can only be exercised on the expiration date, while American options can be exercised on any date before the expiration.
• who will take responsibility for fighting fraud in the absence of the internal or external auditors
• In one U.S.​ city, the taxi cost is $3 plus $0.70 per mile. If you are traveling from the​ airport, there is an additional charge of $4.00 for tolls. How far can you travel from the airport by tax
• Unit V Article Review For this assignment, select and read a journal article on issues addressing public management and leadership roles and
• The class mean at the end of the semester is 73 with a standard deviation of 12.
• Explain the differences between capital market line (CML) and security market line (SML).
• The Millennium Charitable Foundation, which is tax-exempt, issued debt at 9.2% percent to finance a new playground facility in Chicago.
• Variable costing versus absorption costing. The Mavis Company uses an absorption- costing system based on standard costs.
• Larger (c) 10 times larger (d) 100 times larger.
• How do you find the surface area of a cylinder? How do you find the surface area of a prism? Describe what a prism is. How do you know what the base is? How do you know what the height is?
• View All Submissions D. E(p) = 1 Score: Provide an appropriate response. Suppose that $8000 is invested at an interest rate of 5.5% per year,...
• The velocity, v, with which air comes out depends on the radius, r, of your windpipe.
• Please let me know asap.
• Markup percent is based on selling price. Compute the missing terms. Selling Price Markup Percent 100% - Markup Cost a. $2,662 40% ? ?
• Define the term quot;securityquot; with respect to a workplace. What actions can employers take to minimize the risk and impact of workplace
• (10-9) Davis Industries must choose between a gas-powered and an electric-powered forklift truck for moving materials in its factory.
• 1. The probability that event A occurs is .63. The probability that event B occurs is .45. The probability that both events A and B occur is .18. Are...
• Explain how you write products when there are not enough digits in the product to place the decimal point?
• Find an equation that can be used to predict the size of the population at any time t. What is a reasonable domain and range for this function?
• Use Gauss-Jordan elimination to solve the linear system and determine whether the system has a uniquesolution, no solution, or infinitely many...
• Define self and the importance of identity of self for individual. Describe the cognitive structural, self psychology, and symbolic influences of...
• What is the difference between cognition and emotions?
• How do different perspectives (society, managers, and employees) affect the views of compensation?
• Topic Selection amp; Getting Started As you think about the database you will create for your project, consider areas of your life where you have...
• Using Lincoln’s “A House Divided” speech, Walt Whitman’s “O Captain! My Captain!” poem, and Jane Addams’s “Influence of Lincoln” memoir chapter, you are going to write an expository
• 9. What is the current yield of a bond with a coupon rate of 8.5%, maturing in 10 years with a par value of $1,000 and current market price of $832?
• During the 2005 football​ season, Team Tackle beat Team Sack by 3 points. If their combined scores totaled 87​, find the individual team scores.
• In a random sample of 40 refrigerators, the mean repair cost was $145.00 and the population standard deviation is $15. Construct a 90% confidence...
• Need help with editing this research paper, I couldn't upload it, so had to copy paste. I need it ASAP, it needs to be M L A format, and if able to
• 1.In which of the following scenarios would bartering be most likely to become inefficient?
• Dairy Corp. has a $20 million bond obligation outstanding and a coupon rate of 8%. Dairy Corp. has the ability to buy back the debt at 7% above par...
• Which relationship between x and y in the equation shows a proportional relationship? y=4x+2 y=8x y=x−2 y=x2+2
• f the atrocities commited by both sides in the Indian question, how do you feel? Is there anything we can do about the American Indian problems today?...
• XYZ Corp has return on assets (ROA) of 12%. It's total assets and liabilities are $50m and $ 10m respectively. XYZ's return equity (ROE) is closest...
• What are some of the common data security threats?
• Can someone help me with this?
• Homologs which are heterozygous for an inversion have difficulties pairing in meiosis. During pairing homologous regions associate with one another.
• Bodies Rice and energy What food type provides a quick source of energy? What is the simple sugar that fuels our bodies? What is its chemical formula?...
• Do you think hospitals have succeeded in empowering employees on any of the Deming and Crosby's systems Or, is there is still a fear of blame?
• Part A: Fully describe three (3) measures for assessing the effectiveness of a sales force as a whole.
• Plasti-tech Inc. has total debt-to-equity ratio of 0. Currently, its debt has a pretax interest rate of 10%. The firm's common stock trades at $15.00...
• Two angles are complementary angles if the sum of their measures is 90degrees°. Angle A and angle B are complementary angles, and angle A is 21 degrees° more than twice angle B. Find the measures o
• Your Mobile Ordering Project team assigned you to write the Mobile Ordering Project POS Requirements Document.Include the following elements in your documentation:Identification of the core components
• Question 1: You wish to conduct an ANOVA (one way/omnibus) in your ASCI 691 capstone project.
• If sufficient acid is used to react completely with 3.78 grams of zinc, what volume of hydrogen would be produced at STP?
• Squash Delight, Inc. has the following capital section in its balance sheet. Show the effect on the capital account(s) of a two-for-one stock split.
• USE CASE #1 Organizations globally are adopting the concept of BYOD (Bring Your Own Device). enabling users to compute using cloud technologies and use Web-based tools including social media sites as
• In simple linear regression, which of the following statements indicates there is no linear relationship between the variables x and y ?
• Philosophers long ago thought about an ideal society, but the science of sociology is relatively new.
• Which of the following is a true statement in regard to art for children under three?
• Use Substitution for the following system 5x+4y=16 y=2x-9
• Which of the following is most likely a goal of direct marketing?
• Suppose that the New England colonials baseball team is equally likely to win a game as not to win it.
• An Italian company is considering expanding the sales of its cappuccino machines to the U. market. As a result, the idea of setting up a...
• Bath Products Ltd manufactures a variety of bath and beauty products for specialty stores.
• Cathy went to Best Buy to buy a Sony 42" flat screen TV Best Buy had run an ad for the TVs which said "Regularly priced at $700, now just $199.
• Duration is defined as the weighted average time to maturity of a financial instrument. List at least four other key things you know about duration.
• Lockboxes and Collections It takes Cookie Cutter Modular Homes, Inc., about five days to receive and deposit checks from customers.
• ) Plot and write the following functions. Use the Desmos calculator for plotting. y 1 = 5e x + 2 b. y 2 = shift y 1 down 1 unit c. y 3 = shift y 1 to...
• What do we mean by a "utopian community"? Where there different kinds of them? Describe the North American Phalanx. How did it work?
• Read this excerpt from "A Visit from the Goon Squad." That’s when he began singing the songs he’d been writing for years underground, songs no one had ever heard, or anything like them—“Eyes i
• Choose a professional nursing organization that relates to the nursing profession or your clinical practice area.
• Instructions for students Many individuals have played a crucial role in advancing the fields of public health and health education.
• describe the molecular basis for 3 different epigenetic phenotypes
• The de Broglie wavelength of an electron with a velocity of 7.40 10 6 m/s is ________ m. The mass of the electron is 9.11 10 -28 g. pick an answer:83...
• What is the WACC for a firm with 40% debt and 60% equity that pays 12% on its debt, 20% on its equity, and has a 40% tax rate?
• Discuss Goldratt's observations regarding critical chain. What is the problem that he is trying to address, how does he go about analyzing the
• Hi, do you by chance have any study material on final exam for classroom component of NURS 6640- Individual Psychotherapy of Walden University?
• a client with hypokalemia is ordered potassium chloride. identity 3 points to teach the client about proir to first dose?
• Suppose you sell a fixed asset for $125,000 when its book value is $145,000. If your company's marginal tax rate is 35 percent, what will be the...
• You are trying to pick the least-expensive car for your new delivery service. You have two choices:
• What should be the beta of a replacement stock if an investor wishes to achieve a portfolio beta of 1.2 by replacing stock C in the following equally...
• The coordinates below are the three vertices of a rectangle. Identify the fourth coordinate and the area of the rectangle. (2, 7), 28 units squared (2, 7), 45 units squared (7, 2), 28 units squared (
• John junior invests a total of $500 every month in a Roth IRA account. HE expects to retire after 30 years. He also expects that his investments in a...
• If you want to purchase a home. You have $25,000 to put down. All you can afford is $1500.00 per month and you do not want to finance for more than...
• The team. .attacked but couldn’t score a goal. Then, through a/an. .ordinary piece of good fortune, the other team accidentally kicked the ball into th
• The Science Road Show (SRS) is a not-for-profit organization that puts on traveling science demonstrations throughout the state. SRS operates on a...
• Part A In this first portion of the assignment you are asked to analyze the iconography of the artworks listed below. Defined in the textbook,
• Find standard deviation of returns of a 3-stock portfolio (each stock being equally weighted) that produced returns of 20%, 25%, and 30%
• Which statements accurately describe results of America's entry into World War I? Choose all answers that are correct. A. Germany was defeated and made to pay reparations. B. The United States beca
• the initial velocity of a car is 45 km/h in the positive x direction. the final velocity of the car is 66km/h in a direction that points 75 degrees...
• Describe and discuss methods of backflush costing?
• Answer QUESTION quot; Dquot; ONLY AND SHOW FULL WORK AND EXPLANATION! (20 points), loan with annuity. present value in excel You're given with a...
• Pollutants can harm ecosystem function and may also harm human health. You will write an APA research paper about pollutants, their impacts, and...
• What does sigma mean in statistics and how do you write the sign?
• Err Company has a major lawsuit against them for unsafe products. It recognizes a huge liability in 2008 of $300M. The effect of this liability is to...
• If activity x is on the critical path, the slack for x will equal: (a) LF - EF. (b) LS - ES. (c) zero.
• The hour hand on the town clock tower is 20 feet long and the minute hand is 31 feet long. Find the distance between the ends of the hands when the...
• amie is a self-employed accountant who has been certified in his state. He mostly prepares financial records for small businesses and helps...
• Enos Inc. is a construction company specializing in custom patios. The patios are constructed of concrete, brick, fiberglass, and lumber, depending...
• Which of the following statements is correct?
• Scrap rates per thousand (parts whose defects cannot be reworked) are compared for 5 randomly selected days at three plants. Does the data prove a
• Which of the following is true about accounts payable?
• east three key moments in the early 1800 when federal authority clashed with state authority what trend developed in the resolution of these disputes...
• Which of the following was a result of slave raiding by Portuguese slavers in Kongo? A. Portugal went to war with England B. Relations between Kongo leaders and the Portuguese became strained C. Port
• I need help with some questions for my tech 230 class. Do you think the Luddites were successful in their endeavors?
• POST MBA Please see upload for the information
• Gran Torino: Should Walt help Thao and his family?
• compare the egyption statue of menkaure and queen to the greek statue riace warrior.
• Should groups always approach conflict resolution through collaborative rather than competitive methods?
• Using Sandbrook's mad as hell, discuss the influence of social darwinism on the Regan revolution (not just Ronald Regans attitudes.
• is the common ion effect and how may the common ion effect be used to prevent the dissolution of certain sparingly soluble salts into water solution?...
• I NEED HELP PLEASE!!!!! I don't understand this. Can someone please explain how can I find the solution to this? Can someone at least explain how I
• You have mutually exclusive projects and want to decide based on IRR If you require 14%, which one you need to choose with given information and why?...
• Consider the following reaction: CO2(g)+CCl4(g)2COCl2(g) Calculate G for this reaction at25 Cunder these conditions: P CO2 = 0.140 atm P CCl4 = 0.185...
• The common stock of Cranberry Inc. is selling for $22.60 on the open market. Next years dividend is expected to be $2.50, and the growth rate of this...
• Outline the differences in Evaluation and Research
• A project has expected sales of 6,000 units, a selling price of $29 a unit, variable costs equal to 60% of sales, fixed costs of $32,000, and...
• Which salts will be more soluble in an acidic solution than in pure water? 1)PbSO4 2)KClO4 3)CuBr 4)BaSO3 5)Ni(OH)2 There is more than one correct answer Thanks in advance :)
• how to balance equation NH 4 NO 3 = N 2 O + H 2 O Pb(C 2 H 3 O 2 ) 2 + H 2 S = PbS + HC 2 H 3 O 2
• A piano tuner stretches a steel piano wire with a tension of 910 . The wire is 0.400 long and has a mass of 3.40.a) What is the frequency of its
• What are some of the sources of bias that can affect an evaluation? How might such biases be minimized?
• A sealed syringe contains 5cc of oxygen gas under 14.7psi of pressure. If the pressure on the syringe is increased to 36.
• Your Web production company has received an RFP for building an e-commerce Web site for Carlotti's, a renowned gourmet and specialty butcher that now...
• Of the following data, what type would be collected during a physical assessment?
• if the price is $10 and marginal revenue equals marginal costs at $7 at a quantity of 400 lbs.
• Diego pulls a 4.5 kg sled across level snow with a force, F, of 240 N on a rope that is 35.0 above the horizontal, as shown in Figure 10-18. If the...
• Which mutually exclusive project would you select, if Project A costs $1,000 and Project B costs $1,200 and your required return is 15% for both...
• QUESTION quot; 8dquot; ONLY AND SHOW FULL WORK AND EXPLANATION! You are given with the following information of a firm quot;Hungry Jackquot; in...
• e) Explain the Mamp;M proposition 1 in words and intuition. Do not simply copy the equations given in the class or from investopedia and other...
• This paper is only for 4 points so I can't afford more than $20. If anyone is interested they can accept.
• Kneisha and Shawna form the equal KS LLC with a cash distribution of $360,000 from Kenisha and a property contribution (adjusted basis of $380,000,...
• 5. What is the new name Equality 7-2521 gives Liberty 5-3000? How is his act of giving her a name significant?
• One of the major advantages to using point-of-purchase promotion is:
• Briefly answer the following questions: What are gap junctions composed of? What types (and sizes) of solute will they allow to pass between cells?
• Specialized Bicycle Components, Inc. introduced the first major production mountain bike in 1980.
• We are looking at models in finding fair values of stock which may leave the impression that stock prices should not change much.
• The corporate veil would most likely be pierced and the shareholders held personally liable if: The corporation has elected S corporation status...
• What one is a true statement about endothermic reactions? a)energy from an outside source is continuously being added b)the reaction container always feels hot c)the reactants have less heat energy th
• Edit and advise Journal AssignmentTo make it more organized more content. This portfolio differs from others because the information that you will use in your responses will come from doing research.
• Scientists are telling us that Planet Earth is coming down - collapsing - because people are obliterating Earth's environments and its natural...
• Question 2 The Beta for FLIR Systems Joey Moss, a recent finance graduate, has just begun his job with the investment firm of Covili and Wyatt.
• What is basal lamina, where is it found, and what is it composed of? How are laminins structured and what is their role within basal lamina?
• Upon treatment with NBS and irradiation with UV light,1-ethyl-4methylbenzene produces exactly three monobrominated compounds(including...
• 32 H a : A. [3 p.] Is this a one-tailed or a two-tailed test?
• The growth of a bug population shows a geometric sequence shown in the table. The pattern continues indefinitely. What will the population be on week 22
• We are evaluating a project that costs $845,000, has an seven-year life, and has no salvage value. Assume that depreciation is straight-line to zero...
• Americans have become increasingly concerned about the rising cost of Medicare.
• Briefly answer: How is cancer influenced by genetics/genetic background? Why do tumor cells have a greater degree of genetic instability than normal
• The first public relations practitioners were primarily theatrical agents who staged stunts to get newspaper coverage for their clients.
• Prepare an 8- to 10-slide Microsoft PowerPoint presentation for the newly elected board members using the same CAFR from Week One.
• What is the cancer stem cell theory? What are cancer stem cells and transit amplifying cells? How do they differ?
• myrab9999 posted a question Jan 26, 2013 at 10:25am This was posted by a previous student...was there ever an answer?
• Research paper on laboratory procedure/techniqueYou are required to research and write a report on a new laboratory procedure, serological, diagnostic test/technique used in a microbiology/medical la
• is it possible that an outright ban on foreign imports will have no effect on the equilibrium price?
• 11 multiple choice english questions.Read the passage then complete the questions about it !
• Candace manages a popular, urban hair salon. During the day-to-day operations of the salon, Candace has to pay her staff and the costs of maintaining...
• Where is the limbic system located? Which structures make up this system? How is the limbic system important in behavior?
• Brief Exercise 19-8 Markowis Corporation sells three different models of mosquito "zapper." Model A12 sells for $50 and has variable costs of $40.
• What is the polarized membrane state? How is it maintained?