Waiting for answer This question has not been answered yet. You can hire a professional tutor to get the answer.
QUESTION
1. A) (2 points) Translate the following code into a peptide sequence , starting with the leftmost base: 5' AUCAAGGGUCUUCCGUGCGAUCAGAUCUAUUGUUAA 3'
3'
B) (1 point) On which side would the N-terminus be?
C) (1 point) Could trypsin cleave this peptide? What about thrombin?
D) (2 points) What types of non-H-bond, tertiary interactions could this peptide make?
E) (Bonus point) If this peptide was exposed to
trypsin, and then to a thiol-disulfide oxidoreductase, what neurotransmitter would it make?
