Can you please help with #3 (principles of Biology I course):

3 . ( 2 pts . ) You are sequencing the end of a genomic DNA fragment that was cut with therestriction enzyme BamIII and ligated into a plasmid that was also cut with BamHI . Youhave denatured the DNA and annealed a labeled primer to plasmid sequences adjacent tothe insertion site as shown belowBamHIGAT CTA GCTAG CTA GCTAG CTA GOTA G CTA GC CAT CGAT GCTAGGART CITIGOTGATGCTAGTCGATGCCGTAGCACTACGATCAGOTACGGC3 18 base primer 5Next you add DNA polymerase , buffer , an excess of all four dNTPS , and a small amountof daAIR . Write out the sequences of the four shortest extension products , along with thesize of each product in base pairs