Waiting for answer This question has not been answered yet. You can hire a professional tutor to get the answer.
QUESTION
Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first t
- Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
-
- aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
-
- aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc