Using the codon table provided below, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the...

Using the codon table provided below, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.

I. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

II. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Notice that the second strand has a point deletion (the u in bold) with respect to the first strand - comment on how this has affected the resulting peptide chain.