You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will iden

You are assigned two unknown bacteria.  One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will identify according to the simplified DNA Barcoding steps below. 

These two bacteria may or may not be the same, not intentionally assigned one way or the other. You will submit your completed report as the TEXT in email by ‘Reply’ to the ‘Unknown Bacteria” email.  Attachment is NOT acceptable. 

Part 1 Bergey’s  

Amy’s lab note for Unknown 47 test results is copied below. 

Use the tests discussed in BIO 150 Lab and the ‘ID Notes’ to identify Amy’s unknown. 

Complete the ID Report below.  Your ID Report should include interpretation of the observations described in Amy’s note; that is, you need to state the meaning of the results in microbiology terms. 

Amy’s Unknown 47 

Gram staining: appeared pink, rod shape 

Colony diameter: about 1-2 mm 

FTM: growth throughout 

Durham glucose: yellow, bubble in the inverted glass vial 

Durham lactose: yellow, bubble in the inverted glass vial 

Kligler’s: entire tube turned yellow, yellow butt, yellow slant, medium cracked up, no black color 

MSA: red, no growth  

Semisolid stab: molds! tube appeared milky? 

Gelatin stab: green mold on top of medium, gross! 

Citrate test: green 

Urease test: no color change 

Catalase: bubbles 

Endospore staining: red rods 

Acid-fast staining: blue rods 

Part 2 DNA Barcoding 

Follow the following steps to identify your DB unknown.   

The sequence of your DB unknown is copied below. 

Type pubmed.gov into browser 

Click on NCBI, National Center for Biotechnology Information (upper left corner) 

Click on BLAST (right hand side, under ‘Popular Resources’) 

Click on Nucleotide BLAST (nucleotide > nucleotide) 

The page opens up is ‘Standard Nucleotide BLAST’ 

Enter your sequence to the box ‘Enter Query Sequence’ 

Leave everything as default (that is, do not change setting) 

Scroll down  

Click on ‘BLAST’ button on the lower left 

Wait for a few seconds 

Scroll down to review the results 

Answer questions in the ID Report below. 

DB#5 

AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG 

CAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGA 

TAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTT 

GCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAG 

CTGGTCTGAGAGGATGACCAGCAACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG 

GGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCNGCGTGTATGAAGAAGGCCTTCGGGTTGT 

AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAA 

GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGC 

GTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTG 

ATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCT 

ID Report 

Your Name –  

Part 1 Bergey’s 

Amy’s Unknown Number –  _____; Identification –   

A. Interpret all of Amy’s Unknown test results listed in Part I above: 

B. Stepwise Reasoning: (state your rationale; describe how you identified the unknown, based on what; how the other possibilities are ruled out, etc.  It is very important to systemically eliminate the other possibilities, step by step, dichotomous manner.) 

C. One paragraph describing the disease(s) this unknown bacterium may cause: 

D. Reference citation: (cite the sources of information) 

Part 2 DNA Barcoding 

Unknown DB Number –  _____; Identification –   

1.    What is the name this unknown bacterium according to the NCBI BLAST sequence analysis? 

2.    Can the bacterium of the unknown DB# _____ possibly be the same bacterium as Amy’s unknown # _____? 

3.    Name two test results (any two among the ones discussed in our BIO 150 Lab) that can support your answer to (1).  Name another two test results that can support your answer to (2).