-
Your grandfather clock's pendulum has a length of 0.9930 m. If the clock runs slow and loses 21 s per day, how should you adjust the length of the
-
A hydrogen molecule consists of two hydrogen atoms whose total mass is 5.
$15.00
Science
Waiting for answer
-
Octane has a density of 0.692 g/mL at 20 C. How many grams of are required to burn 1.50 gal of C8H18?
$12.00
Science
Waiting for answer
-
Write Project -Proposal relating to this topic (The impact of obesity in Saudi Arabia) note:
-
A chemistry handbook lists the solubility of sodium Iodide as 184 grams per 100mL of water at 25 degrees celsius. How many moles of NaI can be
-
The way communication has changed the last 50 yearsÂ
-
A proton in a linear accelerator has a de Broglie wavelength of 128 pm what is the speed of the proton?
$15.00
Science
Waiting for answer
-
Apply the variation function x^2(a-x)^2 for x between 0 and a, to the particle in a box and estimate the ground state energy, E_gs.
-
What process will completely stop if you used an herbicide to inhibit PEP-Carboxylase in corn plants?
-
A car accelerates uniformly from 18.5 m/s to 46.1 m/s in 2.47 seconds. Find the acceleration of the car and the distance traveled.
-
Harris, Chapter 1, problem 32: What is the density of 53.4% aqueous NaOH if 16.7 mL of the solution diluted to 2.00L gives 0.169M NaOH?
$20.00
Science
Waiting for answer
-
16. How many equivalent resonance forms can be drawn for SO2 without expanding the octet on the sulfur atom?
$50.00
Science
Waiting for answer
-
A motorcycle accelerates uniformly from rest to a speed of 7.10 m/s over a distance of 35. Determine the acceleration of the motorcycle .
$10.00
Science
Waiting for answer
-
An auto mechanic spills 78. mL of 2.5 M H2SO4 solution from a rebuilt auto battery. How many milliliters of 1.3 M NaHCO3 must be poured on the spill
$20.00
Science
Waiting for answer
-
find the volume of 19.5 g of CCl4 at 972 torr and 29.
$20.00
Science
Waiting for answer
-
The average period of the polar wandering is in excess of 400 days. The annual variations in earth rotation are due to the heating and cooling of the...
$10.00
Science
Waiting for answer
-
2009 Pearson Education, Inc. Our goals for learning: How does a stars mass determine its life story? How are the lives of stars with close companions...
-
1) A groundwater sample is in equilibrium with CaCO3 and CO2(g). The Ca2+ ion concentration is 124 ppm. Determine the concentration of HCO3- (in...
-
Industrial deep-sea divers must breathe a mixture of helium and oxygen to prevent a disorienting condition known as nitrogen narcosis.
-
18. If the solubility of a gas is 7.5 g/L at 404 kPa pressure, what is the solubility of the gas when the pressure is 202 kPa?
-
Do athletes training at high altitudes have more or less oxygen molecules per ml of blood then athletes training at low altitudes?
-
A monatomic ideal gas with initial pressure 1.2*10 5 Pa and initial volume of 0.5 m 3 expends isothermally to a volume of 1.8 m 3 .
-
. If a liquid only half as dense as mercury were used in a barometer, how high would its level be on a day of normal atmospheric pressure
-
A sealed flask contains 0.50 g of water at 28 ^\circ {\rm{C}}. The vapor pressure of water at this temperature is 28.36 {\rm mmHg}.
$20.00
Science
Waiting for answer
-
ody weight an important performance and health protection? What are some potential consequences of an athlete dropping below this minimum body weight?...
-
Discuss four possible effects that may occur when a cell receives instructions from two different hormones
-
A 35kg girl is bouncing on a trampoline. During a certain interval after she leaves the surface of the trampoline, her kinetic energy decreases to...
-
embryonic period A. extends from the seventh month until birth. fetus B. extends from the start of the fourth month to the end of the sixth month....
-
at 27.0 degree Celsius a gas has a volume of 6. what will the volume be at 150.0 degree Celsius. what's the equation for it.
-
1Differentiation is described as the process of a cell becoming more specialized. What is the difference between dedifferentiation and
$50.00
Science
Waiting for answer
-
Healthcare stakeholders disagree about the impact of legal risks, medical malpractice claims, tort reform, and defensive medicine on the cost of care...
-
Arrange the following elements in order of increasing electronegativity.
-
Indicate whether the following species contain an ionic bond or only have covalent bonds.
-
When PCl 5 solidifies, it ionizes according to the following equation: 2PCl 5 gt;PCl 4 + + PCl 6 . Choose the correct molecular geometry of the...
$15.00
Science
Waiting for answer
-
7.1 How Does Glucose Oxidation Release Chemical Energy?
$12.00
Science
Waiting for answer
-
61. If orangutans are the outgroup of humans, chimps and gorillas, what type of chromosomal change resulted in the derived karyotype?
-
Calculate the volume of oxygen you would need, at 1.00 atm and 298 K, to completely oxidize 54 g of glucose.
-
have ragged red fibers accumulating Elderly patients accumulate mtDNA damage So how do these `symptomsquot; of aging happen? What are free radicals?...
$20.00
Science
Waiting for answer
-
3-phosphoglycerate (3-PGA) and dihydroxyacetone phosphate (DHAP) 2. 2 molecules of 3-phosphoglycerate (3-PGA) 3. glyceraldehyde-3-phosphate (GAP)...
$20.00
Science
Waiting for answer
-
21. A very short eukaryotic mRNA has the sequence... 5' ACGCCGAUCAUGGGCAUGCGAGUAUAAAAACUGG 3 ' How many amino acids are encoded by this message?
$35.00
Science
Waiting for answer
-
The concentration, or abundance, of ethyl alcohol in a typical molecular cloud is about 1 molecule per 10 8 cubic meters.
$50.00
Science
Waiting for answer
-
The genome is the complete set of genetic material in an organism. Give 3 other quot;___omequot; terms and what each of them comprises.
$15.00
Science
Waiting for answer
-
please help create a timeline describing the development milestones that occurr in the stages of fertilization, embryonic development, fetal
-
Humans have 10 times as many bacterial cells (prokaryotes) living on and in us than we have eukaryotic cells that make up our bodies.
$10.00
Science
Waiting for answer
-
metal rod is 40.126 long at 20.0 and 40.149 long at 45.4 Calculate the average coefficient of linear expansion of the rod's material for this
-
choose molecular shape linear bent trigonal bipyramidal seesaw square plane tetrahedron icosahedral square pyramidal trigonal pyramid T-shape
$20.00
Science
Waiting for answer
-
In a sphere-lamp model (where the lamp is the Sun and a sphere is the Moon), and your nose is at the longitude (i., the east-west position) of L.
-
Small intestine major function of the intestines What are the functions of intestinal motility? How is intestinal motility controlled?
-
28. differentiate hypotonic, hypertonic and isotonic 29. differentiate simple diffusion, facilitated diffusion active transport and osmosis (i.e.
-
Fermentation, homolactic, heterolactic, lipase, peptidase, photosynthesis, phototroph. Chemotroph, autotroph, heterotroph, Photoautotroph,...