Answered You can hire a professional tutor to get the answer.
I will pay for the following essay Gene Prediction. The essay is to be 2 pages with three to five sources, with in-text citations and a reference page.This corresponds to 331 codons also known as amin
I will pay for the following essay Gene Prediction. The essay is to be 2 pages with three to five sources, with in-text citations and a reference page.
This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039.
The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%.
Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3
ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA.
Fasta formatted sequence was
