-
The reaction, 2NO + Cl 2 2NOCl, has an activation energy of 18.7 kJ mol -1 . At 27 C, k = 20.7 L 2 mol -2 s -1 . Find the temperature (in K) at which...
$20.00
Science
Waiting for answer
-
if the enzyme involved in converting fructose-1, 6-bisphosphate into G3P is present at a lower than normal concentration, how many CO2 will be
$20.00
Science
Waiting for answer
-
Two circular coils of diameter 30.0 cm are parallel to each other and have their centers along the same line L but separated by 22.
-
I'm really lost with this intron splicing trrans-esterification mechanism. I don't understand how it works.
$15.00
Science
Waiting for answer
-
Question 1 How would you manage patients on warfarin in the following four scenarios?
-
Give an Example of a specific behavior and the motivators and emotions that can be behind that behavior.
-
The temperatures TC of the cold reservoirs and the temperatures TH of the hot reservoirs for four Carnot heat engines are engine 1: TC = 400K and TH...
$20.00
Science
Waiting for answer
-
1. The pressures P and volumes V of five ideal gases, with the same number of molecules, are given below. Which has the highest temperature?
-
1 . Given the DNA sequence 5'GTCGTACGATGCCATTA C GAGGTGAGGCTGTTAGCTGATGGTGTTAT3' 3'CAGCATGCTACGGTAAT G CTCCACTCCGACAATCGACTACCACAATA5' What would the...
-
Thin strips of iron and zinc are riveted together to form a bimetallic strip that bends when heated. The iron is on the inside of the bend because:
$15.00
Science
Waiting for answer
-
What would happen to the separation of 3 compounds shown on a TLC plate run in 9:1 ethyl acetate/hexane vs. the separation of the same three
-
A large storage tank, open to the atmosphere at the top and filled with water, develops a small hole in its side at a point 15 m below the water...
$12.00
Science
Waiting for answer
-
A horizontal wire of length 3.0 m carries a current of 6.0 A and is oriented so that the current direction is 60 S of W. The Earth's magnetic field...
-
1 . What process is disrupted in petite mutants ? A. Glycolysis E. Fermentation [. Oxidative Phosphorylation* D. Adenine Metabolism 2. Energy
-
00 liter solution contains 0.42 M ammonia and 0.55 M ammonium chloride . If 0.140 moles of barium hydroxide are added to this system, indicate...
$15.00
Science
Waiting for answer
-
Part II: Drawing Contour Lines 5) Using a contour interval of 10 feet, construct contour lines on Figure 4 (below). Contour Interval = 10ft.
-
1.A buffer solution contains 0.435 M ammonium chloride and 0.211 M ammonia . If 0.0269 moles of sodium hydroxide are added to 150 mL of this buffer,
-
A certain gaseous compound has the empirical formula CH. 50 mL of the gas are introduced into a container from which it effuses in 39.5 min. The same...
-
Describe the changes in speed and direction of the tidal current from ebb to flood back to ebb tide. Suppose the tidal pattern is a simple...
-
Submit a written report, a podcast, or a slideshow to describe the following about the fault you select:
$12.00
Science
Waiting for answer
-
[MT450: Marketing Management] Unit 7 Assignment #1 Assignment: Creating A Sound Promotional and Distribution Strategy In this Assignment, you will be...
$10.00
Science
Waiting for answer
-
How do nurses promote patient safety and improve quality at your workplace? How do you report errors and near misses?
$35.00
Science
Waiting for answer
-
ace station and supplied it with organisms to create an ecosystem to support 6 people for 3 years, what types of organisms should be selected and why?...
$20.00
Science
Waiting for answer
-
MARS EXPLORATION 1 Robots sent to mars recently MARS EXPLORATION 2 Robots sent to mars recently Mars is a planet that can quench the thirst of...
-
A proton moves with a speed of 4700000 m/s horizontally, at a right angle to a magnetic field.
$20.00
Science
Waiting for answer
-
A switch is a circuit that connects n inputs to n outputs by a one-to-one matching in between inputs and outputs.
-
When you lift an object by moving only your forearm, the main lifting muscle in your arm is the biceps. Suppose the mass of a forearm is 1.50 kg.
$50.00
Science
Waiting for answer
-
It is not possible to see very small objects, such as viruses, using an ordinary light microscope. An electron microscope can view such objects using...
-
A proton is initially at rest at a point where the potential is 461 V. Some time later the proton is at a point where the potential is 192 V.
-
Dan is gliding on his skateboard at 4.5 m/s. He suddenly jumps backward off the skateboard, kicking the skateboard forward at 8.0 m/s. How fast is
-
The Kepler Space Telescope was successfully launched a few months ago. It is going to look for Earth's "twin" in a near-by region of the Milky Way.
$20.00
Science
Waiting for answer
-
Which represents the most acidic solution?
-
Two wires, parallel to the z axis and distance 4r apart, carry equal currents I =0.65 A in opposite directions, as shown in Fig. 32-40.
-
A solution of household bleach contains 5.25% sodium hypochlorite, NaOCl, by mass.
-
Compute the equilibrium concentration for Fe3+ at pH= 7 (i.e. [H+] = 1.0 x 10-7). Include the appropriate units. [Fe3+]= ?
-
The length of the bar is .900 m, its mass is .700 kg, and its center of mass is .
$20.00
Science
Waiting for answer
-
All of the following statements regarding diuretics are true EXCEPT:
$15.00
Science
Waiting for answer
-
If an aqueous solution is 2.79 % (w/v) in manganese(II) iodide , , how many grams of manganese(II) iodide are there in a liter of solution?
-
A negative Duarte of 4.0 x^-4 c positive charter of 5.0x10^-4c are separares ny 0.20 what is the magnitudes of the forc between the charges? Is this
$20.00
Science
Waiting for answer
-
Describes the patient that is the subject of the project including diagnoses, medications, and history OR describes the community, its strengths and
$50.00
Science
Waiting for answer
-
A transverse wave on a cord is given by D(x,\,t) = 0.11\,{\rm sin}(4.0x - 24.0t), where D and x are in {\rm m} and t is in {\rm s}.At t =0.
-
For this activity, you will use the "Faraday's Electromagnetic Lab simulation. Select the "Pickup Coil" tab and increase the number of loops to...
-
For this week in discussion you will create a 5 day diet plan for an active toddler and an active teenager.Us the Dietary Guidelines For Americans...
-
The arm in the figure below weighs 44. The force of gravity acting on the arm acts through point A.
-
1-Of the list of solutions in the materials list, check all of the solutions that are expected to have a pH 7. options:10 M hydrochloric acid 0.10...
-
Calculate the wavelength, in nanometers. of the spectral line produced when an electron in a hydrogen atom undergoes the transition from the energy...
$15.00
Science
Waiting for answer
-
How does a genomic library differ from a cDNA library?
-
A quarterback is standing stationary waiting to make a pass when he is tackled from behind by a linebacker moving at 4.75 m/s.
-
You head back to the patient's room to inform the family of the child's condition.
$50.00
Science
Waiting for answer
-
A massless string is wrapped around a solid disk of mass m_1 and tied to a block of mass m_2. The disk is free to rotate on a frictionless horizontal...
