Practice the expressing genes using the rules of transcription and translation. Identify the type of mutation in a scenario and explain what the impact will be on the function of the protein. Your ini

Practice the expressing genes using the rules of transcription and translation.

Identify the type of mutation in a scenario and explain what the impact will be on the function of the protein.

Your initial post will give you the opportunity to transcribe and translate a wildtype and mutant DNA sequence. Afterwards, you should be able to make a prediction on how it might change the function of the protein. Use these instructions to craft your post but please do not post these instructions with your post to make it easier for everyone to review your work. 

• The following piece of DNA is the sense strand of a wildtype protein that codes for an enzyme. Begin by determining the mRNA and the protein sequence. Here is the codon table (on the attachment) you will need for translation.
  • CCGCGAATGATAGAAAGGCCCTTTTAA
• Next, Each mutant has only suffered one base substitution (marked in underline) from the wild type. Determine the new mRNA and the new protein sequence.
  • Mutant A suffered a mutation at an amino acid that is normally located on the outside of this water soluble enzyme but not near its active site.
    • CCGCGAATGATAGAAAAGCCCTTTTAA
    • Antisense strand:
    • mRNA:
    • Protein:
    • Type of Mutation:
  • Mutant B suffered a mutation at an amino acid that is normally located on the the inside of this water soluble enzyme but not near its active site.
    • CCGCGAATGGTAGAAAGGCCCTTTTAA
    • Antisense strand:
    • mRNA:
    • Protein:
    • Type of Mutation:
  • Mutant C suffered a mutation at an amino acid that is normally located at the the active site of this enzyme where it normally forms an ionic bond with a divalent copper cation (Cu2+)
    • CCGCGAATGATAGGAAGGCCCTTTTAA
    • Antisense strand:
    • mRNA:
    • Protein:
    • Type of Mutation:
  • Mutant D suffered a mutation at an amino acid that is normally located at the the active site of this enzyme where it normally forms an ionic bond with a divalent copper cation (Cu2+)
    • CCGCGAATGATAGACAGGCCCTTTTAA
    • Antisense strand:
    • mRNA:
    • Protein:
    • Type of Mutation:
• State the type of mutation that has occurred
• Describe what impact would you predict that this mutation would have on this enzyme? You might need to reference the chemical structure of the amino acids  (in the attachment)  to make your predictions.